Rh3BG143200

DNA-(apurinic or apyrimidinic site)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
12170425 .. 12172490
2066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG143200.1

Sequence Viewer

Length: 291 bp
ATGCTAGGGAGTTCTTCCAGCTCCGGCGCCGACAAATATCCCGATTCTAAGGGGAAAGCTAATAGATGCATACCGATTTTTACACAAAGAGAAGGACATGGAGCGTGGCTTCACCTGGTCAGGAAATCCCTTTGGAAATTTACACCACATAATAAACATACCGGGTGGCTTTCTGGCCGGTATAGAGGCAAAAGGATGAGGACAGAGTACTTCATAGCTGCAGAGAAACTCAAAGATAGGATTGTTTCATGTGAGATGCACTGGCAAGGGATGAATTACAAGGTTGGCTGA

Protein Analysis

96

Amino Acids

11.1

Weight (kDa)

10.13

Isoelectric Point (pI)

26.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 26
AcoI YGGCCR 1 cut(s) 175
AcsI RAATTY 1 cut(s) 137
AcyI GRCGYC 1 cut(s) 27
AfaI GTAC 1 cut(s) 209
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 3 cut(s) 21, 59, 218
AluI AGCT 3 cut(s) 21, 59, 218
AoxI GGCC 1 cut(s) 175
ApeKI GCWGC 1 cut(s) 218
ApoI RAATTY 1 cut(s) 137
AspLEI GCGC 1 cut(s) 29
AsuC2I CCSGG 1 cut(s) 163
AsuHPI GGTGA 1 cut(s) 104
BanI GGYRCC 1 cut(s) 26
BbvI GCAGC 1 cut(s) 205
BciT130I CCWGG 1 cut(s) 116
BcnI CCSGG 1 cut(s) 163
BfaI CTAG 1 cut(s) 5
BfmI CTRYAG 1 cut(s) 219
BfoI RGCGCY 1 cut(s) 30
BisI GCNGC 1 cut(s) 219
BlsI GCNGC 1 cut(s) 220
BmcAI AGTACT 1 cut(s) 209
Bme1390I CCNGG 2 cut(s) 116, 163
BmiI GGNNCC 1 cut(s) 28
BmrFI CCNGG 2 cut(s) 116, 163
BmsI GCATC 2 cut(s) 56, 246
BpuMI CCSGG 1 cut(s) 163
BsaHI GRCGYC 1 cut(s) 27
Bse118I RCCGGY 1 cut(s) 177
Bse1I ACTGG 1 cut(s) 266
BseBI CCWGG 1 cut(s) 116
BseGI GGATG 2 cut(s) 201, 276
BseNI ACTGG 1 cut(s) 266
BseXI GCAGC 1 cut(s) 205
BshFI GGCC 1 cut(s) 177
BshNI GGYRCC 1 cut(s) 26
BsiSI CCGG 3 cut(s) 24, 162, 178
BsnI GGCC 1 cut(s) 177
BspANI GGCC 1 cut(s) 177
BspLI GGNNCC 1 cut(s) 28
BspMAI CTGCAG 1 cut(s) 223
BspT107I GGYRCC 1 cut(s) 26
BsrFI RCCGGY 1 cut(s) 177
BsrI ACTGG 1 cut(s) 266
BssAI RCCGGY 1 cut(s) 177
BssNI GRCGYC 1 cut(s) 27
Bst2UI CCWGG 1 cut(s) 116
BstACI GRCGYC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 48
BstF5I GGATG 2 cut(s) 201, 276
BstH2I RGCGCY 1 cut(s) 30
BstHHI GCGC 1 cut(s) 29
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 2 cut(s) 114, 161
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 1 cut(s) 205
BsuRI GGCC 1 cut(s) 177
BtsCI GGATG 2 cut(s) 201, 276
BtsIMutI CAGTG 1 cut(s) 259
CfoI GCGC 1 cut(s) 29
Cfr10I RCCGGY 1 cut(s) 177
CsiI ACCWGGT 1 cut(s) 114
Csp6I GTAC 1 cut(s) 208
CviAII CATG 2 cut(s) 98, 249
CviJI RGCY 7 cut(s) 21, 59, 109, 169, 177, 218, 288
CviKI_1 RGCY 7 cut(s) 21, 59, 109, 169, 177, 218, 288
CviQI GTAC 1 cut(s) 208
DdeI CTNAG 1 cut(s) 48
DinI GGCGCC 1 cut(s) 28
EaeI YGGCCR 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 114
EcoT22I ATGCAT 1 cut(s) 71
EgeI GGCGCC 1 cut(s) 28
EheI GGCGCC 1 cut(s) 28
FaeI CATG 2 cut(s) 101, 252
FaiI YATR 7 cut(s) 71, 99, 150, 159, 183, 215, 250
FatI CATG 2 cut(s) 97, 248
Fnu4HI GCNGC 1 cut(s) 219
FokI GGATG 2 cut(s) 208, 283
Fsp4HI GCNGC 1 cut(s) 219
FspBI CTAG 1 cut(s) 5
GlaI GCGC 1 cut(s) 28
GluI GCNGC 1 cut(s) 219
HaeII RGCGCY 1 cut(s) 30
HaeIII GGCC 1 cut(s) 177
HapII CCGG 3 cut(s) 24, 162, 178
HhaI GCGC 1 cut(s) 29
Hin1I GRCGYC 1 cut(s) 27
Hin1II CATG 2 cut(s) 101, 252
Hin6I GCGC 1 cut(s) 27
HinP1I GCGC 1 cut(s) 27
HinfI GANTC 1 cut(s) 44
HpaII CCGG 3 cut(s) 24, 162, 178
HphI GGTGA 1 cut(s) 104
Hpy188III TCNNGA 2 cut(s) 41, 121
HpyAV CCTTC 1 cut(s) 86
HpyCH4V TGCA 3 cut(s) 69, 221, 259
HpyF3I CTNAG 1 cut(s) 48
Hsp92I GRCGYC 1 cut(s) 27
Hsp92II CATG 2 cut(s) 101, 252
HspAI GCGC 1 cut(s) 27
KasI GGCGCC 1 cut(s) 26
LmnI GCTCC 2 cut(s) 26, 101
LpnPI CCDG 9 cut(s) 31, 37, 101, 106, 128, 159, 175, 191, 247
Lsp1109I GCAGC 1 cut(s) 205
LweI GCATC 2 cut(s) 56, 246
MabI ACCWGGT 1 cut(s) 114
MaeI CTAG 1 cut(s) 5
MboII GAAGA 1 cut(s) 6
MluCI AATT 2 cut(s) 137, 274
Mly113I GGCGCC 1 cut(s) 27
MnlI CCTC 2 cut(s) 179, 192
Mph1103I ATGCAT 1 cut(s) 71
MspI CCGG 3 cut(s) 24, 162, 178
MspR9I CCNGG 2 cut(s) 116, 163
MvaI CCWGG 1 cut(s) 116
NarI GGCGCC 1 cut(s) 27
NciI CCSGG 1 cut(s) 163
NlaIII CATG 2 cut(s) 101, 252
NlaIV GGNNCC 1 cut(s) 28
NsiI ATGCAT 1 cut(s) 71
PfeI GAWTC 1 cut(s) 44
PkrI GCNGC 1 cut(s) 220
PluTI GGCGCC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 28
PstI CTGCAG 1 cut(s) 223
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
SatI GCNGC 1 cut(s) 219
ScaI AGTACT 1 cut(s) 209
ScrFI CCNGG 2 cut(s) 116, 163
SetI ASST 5 cut(s) 23, 61, 117, 220, 285
SexAI ACCWGGT 1 cut(s) 114
SfaNI GCATC 2 cut(s) 56, 246
SfcI CTRYAG 1 cut(s) 219
SfoI GGCGCC 1 cut(s) 28
Sse9I AATT 2 cut(s) 137, 274
SspDI GGCGCC 1 cut(s) 26
SspMI CTAG 1 cut(s) 5
StyD4I CCNGG 2 cut(s) 114, 161
TasI AATT 2 cut(s) 137, 274
TatI WGTACW 1 cut(s) 207
TfiI GAWTC 1 cut(s) 44
TscAI CASTG 1 cut(s) 266
TseI GCWGC 1 cut(s) 218
TspDTI ATGAA 3 cut(s) 202, 237, 287
TspRI CASTG 1 cut(s) 266
XapI RAATTY 1 cut(s) 137
XspI CTAG 1 cut(s) 5
ZrmI AGTACT 1 cut(s) 209
Zsp2I ATGCAT 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.