Rh5BG061000

DNA-(apurinic or apyrimidinic site)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
5038021 .. 5039531
1511 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG061000.1

Sequence Viewer

Length: 231 bp
ATGACGGGAGTCTCGACTACGTACGTGGGGTTTATTGAGAAGGAAAATGATTTAATCCCTATGGGAAAGCTAATAGATGCATACCGATTTTTACACAAAGAGAAGGACATGGAGCGTGGCTTCTCCTGGTCAGGAAATCCCATTGGAAAGCAAGACCATATGGTTCATGCACATAAGAACTTGCCGTTGAAAATAAATTGGATTACTGTTGTGTTGGTCGAGTTGAAGTGA

Protein Analysis

76

Amino Acids

8.77

Weight (kDa)

8.06

Isoelectric Point (pI)

12.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 23
AgsI TTSAA 2 cut(s) 190, 226
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
Alw26I GTCTC 1 cut(s) 16
BceAI ACGGC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 16
Bme1390I CCNGG 1 cut(s) 127
BmrFI CCNGG 1 cut(s) 127
BmsI GCATC 1 cut(s) 67
BoxI GACNNNNGTC 1 cut(s) 8
BsaAI YACGTR 2 cut(s) 21, 25
BseBI CCWGG 1 cut(s) 127
BsiWI CGTACG 1 cut(s) 21
BsmAI GTCTC 1 cut(s) 16
Bst2UI CCWGG 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 208
BstBAI YACGTR 2 cut(s) 21, 25
BstMAI GTCTC 1 cut(s) 16
BstNI CCWGG 1 cut(s) 127
BstPAI GACNNNNGTC 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 125
BstSNI TACGTA 1 cut(s) 21
Csp6I GTAC 1 cut(s) 22
CviAII CATG 2 cut(s) 109, 167
CviJI RGCY 2 cut(s) 70, 120
CviKI_1 RGCY 2 cut(s) 70, 120
CviQI GTAC 1 cut(s) 22
Eco105I TACGTA 1 cut(s) 21
EcoRII CCWGG 1 cut(s) 125
EcoT22I ATGCAT 1 cut(s) 82
FaeI CATG 2 cut(s) 112, 170
FaiI YATR 7 cut(s) 62, 82, 110, 159, 161, 168, 174
FatI CATG 2 cut(s) 108, 166
FauNDI CATATG 1 cut(s) 159
Hin1II CATG 2 cut(s) 112, 170
HinfI GANTC 1 cut(s) 9
Hpy188III TCNNGA 2 cut(s) 13, 132
HpyAV CCTTC 2 cut(s) 34, 97
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4IV ACGT 2 cut(s) 20, 24
HpyCH4V TGCA 2 cut(s) 80, 170
HpySE526I ACGT 2 cut(s) 20, 24
Hsp92II CATG 2 cut(s) 112, 170
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 3 cut(s) 112, 117, 139
LweI GCATC 1 cut(s) 67
MaeII ACGT 2 cut(s) 20, 24
MluCI AATT 1 cut(s) 196
MlyI GAGTC 1 cut(s) 18
Mph1103I ATGCAT 1 cut(s) 82
MseI TTAA 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 127
MvaI CCWGG 1 cut(s) 127
NdeI CATATG 1 cut(s) 159
NlaIII CATG 2 cut(s) 112, 170
NsiI ATGCAT 1 cut(s) 82
PcsI WCGNNNNNNNCGW 1 cut(s) 11
Pfl23II CGTACG 1 cut(s) 21
PleI GAGTC 1 cut(s) 17
PpsI GAGTC 1 cut(s) 17
Ppu21I YACGTR 2 cut(s) 21, 25
PshAI GACNNNNGTC 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PspLI CGTACG 1 cut(s) 21
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SaqAI TTAA 1 cut(s) 53
SchI GAGTC 1 cut(s) 18
ScrFI CCNGG 1 cut(s) 127
SetI ASST 3 cut(s) 23, 27, 72
SfaNI GCATC 1 cut(s) 67
SnaBI TACGTA 1 cut(s) 21
Sse9I AATT 1 cut(s) 196
StyD4I CCNGG 1 cut(s) 125
TaaI ACNGT 1 cut(s) 208
TaiI ACGT 2 cut(s) 23, 27
TaqI TCGA 2 cut(s) 14, 219
TasI AATT 1 cut(s) 196
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 155
Zsp2I ATGCAT 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.