Rroxscaffold_2G00103810

Belongs to the mitochondrial carrier (TC 2.A.29) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0005939
Physical Location & Seq
Reverse (-)
26817451 .. 26824392
6942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00103810.1

Sequence Viewer

Length: 312 bp
ATGCTCACTACCTGCGTCACCCAACCCATCGATATGATCAAGGTGAGAATTCAATTGGGTCAGGGATCAGCAGGACAAGTTGCCAGGACCATGATCAAGGAGGAGGGTTTCGGTTCATTGTATAAGGTGAGAATTCAATTGGGTCAGGGATCAGCTGGACAAGTTGCCAGGACCATGATCAAGGAGGAGGGTTTCGGTTCATTGTATAAGGTGAGAATTCAATTGGGTCAGGGATCAGCTGGACAAGTTGCCAGGACCATGATCAAGGAGGAGGGTTTTGGTTCATTGTATAAGGCATGCATGCTTATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Mito_carr

Protein Analysis

103

Amino Acids

11.15

Weight (kDa)

9.69

Isoelectric Point (pI)

18.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mito_carr PF00153 1 - 42 9.4e-08 Mitochondrial carrier protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 20
AclWI GGATC 3 cut(s) 73, 157, 241
AcsI RAATTY 3 cut(s) 48, 132, 216
AgsI TTSAA 3 cut(s) 53, 137, 221
AjnI CCWGG 3 cut(s) 83, 167, 251
AluBI AGCT 2 cut(s) 155, 239
AluI AGCT 2 cut(s) 155, 239
AlwI GGATC 3 cut(s) 73, 157, 241
ApoI RAATTY 3 cut(s) 48, 132, 216
AspS9I GGNCC 3 cut(s) 87, 171, 255
AsuHPI GGTGA 4 cut(s) 10, 55, 139, 223
AvaII GGWCC 3 cut(s) 87, 171, 255
BccI CCATC 1 cut(s) 35
BciT130I CCWGG 3 cut(s) 85, 169, 253
BclI TGATCA 4 cut(s) 36, 93, 177, 261
BfuAI ACCTGC 1 cut(s) 20
Bme1390I CCNGG 3 cut(s) 85, 169, 253
Bme18I GGWCC 3 cut(s) 87, 171, 255
BmgT120I GGNCC 3 cut(s) 87, 171, 255
BmrFI CCNGG 3 cut(s) 85, 169, 253
Bsa29I ATCGAT 1 cut(s) 30
BseBI CCWGG 3 cut(s) 85, 169, 253
BseCI ATCGAT 1 cut(s) 30
BseRI GAGGAG 3 cut(s) 116, 200, 284
BshVI ATCGAT 1 cut(s) 30
Bsp143I GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
BspDI ATCGAT 1 cut(s) 30
BspMI ACCTGC 1 cut(s) 20
BspPI GGATC 3 cut(s) 73, 157, 241
BssMI GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
Bst2UI CCWGG 3 cut(s) 85, 169, 253
BstC8I GCNNGC 2 cut(s) 298, 302
BstKTI GATC 7 cut(s) 39, 68, 96, 152, 180, 236, 264
BstMBI GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
BstNI CCWGG 3 cut(s) 85, 169, 253
BstNSI RCATGY 2 cut(s) 300, 304
BstSCI CCNGG 3 cut(s) 83, 167, 251
Bsu15I ATCGAT 1 cut(s) 30
BsuTUI ATCGAT 1 cut(s) 30
BveI ACCTGC 1 cut(s) 20
Cac8I GCNNGC 2 cut(s) 298, 302
Cfr13I GGNCC 3 cut(s) 87, 171, 255
ClaI ATCGAT 1 cut(s) 30
CseI GACGC 1 cut(s) 4
CviAII CATG 5 cut(s) 91, 175, 259, 297, 301
CviJI RGCY 2 cut(s) 155, 239
CviKI_1 RGCY 2 cut(s) 155, 239
DpnI GATC 7 cut(s) 38, 67, 95, 151, 179, 235, 263
DpnII GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
Eco47I GGWCC 3 cut(s) 87, 171, 255
EcoRI GAATTC 3 cut(s) 48, 132, 216
EcoRII CCWGG 3 cut(s) 83, 167, 251
EcoT22I ATGCAT 1 cut(s) 302
FaeI CATG 5 cut(s) 94, 178, 262, 300, 304
FaiI YATR 9 cut(s) 35, 92, 123, 176, 207, 260, 291, 298, 302
FatI CATG 5 cut(s) 90, 174, 258, 296, 300
FbaI TGATCA 4 cut(s) 36, 93, 177, 261
HgaI GACGC 1 cut(s) 4
Hin1II CATG 5 cut(s) 94, 178, 262, 300, 304
HphI GGTGA 4 cut(s) 10, 55, 139, 223
HpyCH4V TGCA 1 cut(s) 300
Hsp92II CATG 5 cut(s) 94, 178, 262, 300, 304
Ksp22I TGATCA 4 cut(s) 36, 93, 177, 261
Kzo9I GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
MaeIII GTNAC 1 cut(s) 16
MalI GATC 7 cut(s) 38, 67, 95, 151, 179, 235, 263
MboI GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
MfeI CAATTG 3 cut(s) 53, 137, 221
MluCI AATT 6 cut(s) 48, 53, 132, 137, 216, 221
MnlI CCTC 6 cut(s) 94, 97, 178, 181, 262, 265
Mph1103I ATGCAT 1 cut(s) 302
MseI TTAA 1 cut(s) 310
MslI CAYNNNNRTG 1 cut(s) 32
MspA1I CMGCKG 2 cut(s) 155, 239
MspR9I CCNGG 3 cut(s) 85, 169, 253
MunI CAATTG 3 cut(s) 53, 137, 221
MvaI CCWGG 3 cut(s) 85, 169, 253
NdeII GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
NlaIII CATG 5 cut(s) 94, 178, 262, 300, 304
NmuCI GTSAC 1 cut(s) 16
NsiI ATGCAT 1 cut(s) 302
NspI RCATGY 2 cut(s) 300, 304
PaeI GCATGC 2 cut(s) 300, 304
Psp6I CCWGG 3 cut(s) 83, 167, 251
PspGI CCWGG 3 cut(s) 83, 167, 251
PspPI GGNCC 3 cut(s) 87, 171, 255
PvuII CAGCTG 2 cut(s) 155, 239
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 310
Sau3AI GATC 7 cut(s) 36, 65, 93, 149, 177, 233, 261
Sau96I GGNCC 3 cut(s) 87, 171, 255
ScrFI CCNGG 3 cut(s) 85, 169, 253
SetI ASST 6 cut(s) 14, 45, 129, 157, 213, 241
SinI GGWCC 3 cut(s) 87, 171, 255
SmiMI CAYNNNNRTG 1 cut(s) 32
SphI GCATGC 2 cut(s) 300, 304
Sse9I AATT 6 cut(s) 48, 53, 132, 137, 216, 221
StyD4I CCNGG 3 cut(s) 83, 167, 251
TaqI TCGA 1 cut(s) 30
TasI AATT 6 cut(s) 48, 53, 132, 137, 216, 221
Tru1I TTAA 1 cut(s) 310
Tru9I TTAA 1 cut(s) 310
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
TspDTI ATGAA 3 cut(s) 105, 189, 273
VpaK11BI GGWCC 3 cut(s) 87, 171, 255
XapI RAATTY 3 cut(s) 48, 132, 216
XceI RCATGY 2 cut(s) 300, 304
Zsp2I ATGCAT 1 cut(s) 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.