Rh6AG138300

Belongs to the mitochondrial carrier (TC 2.A.29) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0005939
Physical Location & Seq
Forward (+)
21196027 .. 21199390
3364 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG138300.1

Sequence Viewer

Length: 258 bp
ATGAGAGAGGTTATGATTGTTGGATTTCCAACCTATCGATATGATGAAGGTGAGTGGCTCGCACTGATGTTGCGCGTGGCTCGCATCTCAACTATTTCTAGTATGCTCGCTACCTGCGTCATCCAACCTATCGATATGATGAAGGTGAGAATTCAATTGGATCAGGGATCAGCTGGACAAGTTGCCAGGACCATGATCAAGAAGGAGGGTTTTGGTTCATTGTATAAGGTAGGCTTATTTGGTGTGAATACAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Mito_carr

Protein Analysis

85

Amino Acids

9.52

Weight (kDa)

9.36

Isoelectric Point (pI)

7.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mito_carr PF00153 29 - 76 2.8e-09 Mitochondrial carrier protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 122
AccII CGCG 1 cut(s) 75
AclWI GGATC 2 cut(s) 168, 175
AcsI RAATTY 1 cut(s) 150
AgsI TTSAA 1 cut(s) 155
AjnI CCWGG 1 cut(s) 185
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AlwI GGATC 2 cut(s) 168, 175
ApoI RAATTY 1 cut(s) 150
AspLEI GCGC 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 189
AsuHPI GGTGA 2 cut(s) 62, 157
AvaII GGWCC 1 cut(s) 189
BciT130I CCWGG 1 cut(s) 187
BclI TGATCA 1 cut(s) 195
BfaI CTAG 1 cut(s) 99
BfuAI ACCTGC 1 cut(s) 122
Bme1390I CCNGG 1 cut(s) 187
Bme18I GGWCC 1 cut(s) 189
BmgT120I GGNCC 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 187
BmsI GCATC 1 cut(s) 93
Bsa29I ATCGAT 2 cut(s) 37, 132
BseBI CCWGG 1 cut(s) 187
BseCI ATCGAT 2 cut(s) 37, 132
BseGI GGATG 1 cut(s) 120
Bsh1236I CGCG 1 cut(s) 75
BshVI ATCGAT 2 cut(s) 37, 132
Bsp143I GATC 3 cut(s) 160, 167, 195
BspDI ATCGAT 2 cut(s) 37, 132
BspFNI CGCG 1 cut(s) 75
BspMI ACCTGC 1 cut(s) 122
BspPI GGATC 2 cut(s) 168, 175
BssMI GATC 3 cut(s) 160, 167, 195
Bst2UI CCWGG 1 cut(s) 187
Bst4CI ACNGT 1 cut(s) 253
BstC8I GCNNGC 3 cut(s) 60, 82, 108
BstF5I GGATG 1 cut(s) 120
BstFNI CGCG 1 cut(s) 75
BstHHI GCGC 1 cut(s) 75
BstKTI GATC 3 cut(s) 163, 170, 198
BstMBI GATC 3 cut(s) 160, 167, 195
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstNI CCWGG 1 cut(s) 187
BstSCI CCNGG 1 cut(s) 185
BstUI CGCG 1 cut(s) 75
Bsu15I ATCGAT 2 cut(s) 37, 132
BsuTUI ATCGAT 2 cut(s) 37, 132
BtsCI GGATG 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 62
BveI ACCTGC 1 cut(s) 122
Cac8I GCNNGC 3 cut(s) 60, 82, 108
CfoI GCGC 1 cut(s) 75
Cfr13I GGNCC 1 cut(s) 189
ClaI ATCGAT 2 cut(s) 37, 132
CseI GACGC 1 cut(s) 106
CviAII CATG 1 cut(s) 193
CviJI RGCY 4 cut(s) 58, 80, 173, 234
CviKI_1 RGCY 4 cut(s) 58, 80, 173, 234
DpnI GATC 3 cut(s) 162, 169, 197
DpnII GATC 3 cut(s) 160, 167, 195
Eco47I GGWCC 1 cut(s) 189
EcoRI GAATTC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 185
FaeI CATG 1 cut(s) 196
FaiI YATR 6 cut(s) 14, 42, 104, 137, 194, 225
FalI AAGNNNNNCTT 2 cut(s) 218, 250
FatI CATG 1 cut(s) 192
FbaI TGATCA 1 cut(s) 195
FokI GGATG 1 cut(s) 107
FspBI CTAG 1 cut(s) 99
GlaI GCGC 1 cut(s) 74
HgaI GACGC 1 cut(s) 106
HhaI GCGC 1 cut(s) 75
Hin1II CATG 1 cut(s) 196
Hin6I GCGC 1 cut(s) 73
HinP1I GCGC 1 cut(s) 73
HphI GGTGA 2 cut(s) 62, 157
Hpy188III TCNNGA 1 cut(s) 199
HpyAV CCTTC 3 cut(s) 41, 136, 196
HpyCH4III ACNGT 1 cut(s) 253
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
Hsp92II CATG 1 cut(s) 196
HspAI GCGC 1 cut(s) 73
Ksp22I TGATCA 1 cut(s) 195
Kzo9I GATC 3 cut(s) 160, 167, 195
LpnPI CCDG 5 cut(s) 127, 149, 159, 172, 199
LweI GCATC 1 cut(s) 93
MaeI CTAG 1 cut(s) 99
MalI GATC 3 cut(s) 162, 169, 197
MboI GATC 3 cut(s) 160, 167, 195
MfeI CAATTG 1 cut(s) 155
MluCI AATT 2 cut(s) 150, 155
MmeI TCCRAC 2 cut(s) 53, 148
MnlI CCTC 1 cut(s) 199
MspA1I CMGCKG 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 187
MunI CAATTG 1 cut(s) 155
MvaI CCWGG 1 cut(s) 187
MvnI CGCG 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 81
NdeII GATC 3 cut(s) 160, 167, 195
NlaIII CATG 1 cut(s) 196
PcsI WCGNNNNNNNCGW 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 185
PspGI CCWGG 1 cut(s) 185
PspPI GGNCC 1 cut(s) 189
PvuII CAGCTG 1 cut(s) 173
Sau3AI GATC 3 cut(s) 160, 167, 195
Sau96I GGNCC 1 cut(s) 189
ScrFI CCNGG 1 cut(s) 187
SetI ASST 8 cut(s) 12, 35, 52, 116, 130, 147, 175, 231
SfaNI GCATC 1 cut(s) 93
SinI GGWCC 1 cut(s) 189
Sse9I AATT 2 cut(s) 150, 155
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 185
TaaI ACNGT 1 cut(s) 253
TaqI TCGA 2 cut(s) 37, 132
TasI AATT 2 cut(s) 150, 155
TscAI CASTG 1 cut(s) 69
TspDTI ATGAA 3 cut(s) 60, 155, 207
TspRI CASTG 1 cut(s) 69
VpaK11BI GGWCC 1 cut(s) 189
XapI RAATTY 1 cut(s) 150
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.