Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7B

Orthogroup ID

OG0005939

Physical Location & Seq

Genomic Coordinates Reverse (-)

21828475 .. 21840260

Gene Structure 11786 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7BG245200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

ATGCAGAAGATTACTTTATTCAAGGAGAAACAATGCCCTGGGAAGCAAGTGAGAATTCAATTGGGTCAGGGATCAGCTGGACAAGTTGCCAGGACCATGATCAAGGAGGAGGGTTTCGGTTCATTGTATAAGGTGAGAATTCAATTGGGTCAGGGATCAGCTGGACAAGTTGCTAGGACCATGATCAAGGAGGAGGGTTTTGGTTCATTGTATAAGCATATACTTGGAAAACTTATACAATTGGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mito_carr

Protein Analysis

82

Amino Acids

9.01

Weight (kDa)

10.08

Isoelectric Point (pI)

19.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005939)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0485741 RchiOBHm_Chr4g0401931 RchiOBHm_Chr5g0050431 RchiOBHm_Chr5g0082021
rosa_laevigata	RLG00000001409 RLG00000035629
rosa_multiflora	Rmu_sc0000882.1_g000016 Rmu_sc0002345.1_g000024 Rmu_sc0005529.1_g000010 Rmu_sc0005715.1_g000006 Rmu_sc0008931.1_g000003
rosa_roxburghii	Rroxscaffold_2G00103810 Rroxscaffold_3G00224270 Rroxscaffold_6G00406150
rosa_rugosa	Rorug05G0086300 Rorug05G0525400
rosa_samantha	Rh2BG482000 Rh2CG308200 Rh4CG031900 Rh4CG130000 Rh5AG312800 Rh5BG342800 Rh6AG129700 Rh6AG138300 Rh6AG154900 Rh7BG245200 Rh7CG257600 Rh7CG295100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	79, 163
AcsI	RAATTY	2 cut(s)	54, 138
AgsI	TTSAA	3 cut(s)	22, 59, 143
AjnI	CCWGG	2 cut(s)	37, 89
AluBI	AGCT	2 cut(s)	77, 161
AluI	AGCT	2 cut(s)	77, 161
AlwI	GGATC	2 cut(s)	79, 163
ApoI	RAATTY	2 cut(s)	54, 138
AspS9I	GGNCC	2 cut(s)	93, 177
AsuHPI	GGTGA	1 cut(s)	145
AvaII	GGWCC	2 cut(s)	93, 177
BciT130I	CCWGG	2 cut(s)	39, 91
BclI	TGATCA	2 cut(s)	99, 183
BfaI	CTAG	1 cut(s)	174
Bme1390I	CCNGG	2 cut(s)	39, 91
Bme18I	GGWCC	2 cut(s)	93, 177
BmgT120I	GGNCC	2 cut(s)	93, 177
BmrFI	CCNGG	2 cut(s)	39, 91
BsaJI	CCNNGG	2 cut(s)	37, 38
BseBI	CCWGG	2 cut(s)	39, 91
BseDI	CCNNGG	2 cut(s)	37, 38
BseRI	GAGGAG	2 cut(s)	122, 206
Bsp143I	GATC	4 cut(s)	71, 99, 155, 183
BspPI	GGATC	2 cut(s)	79, 163
BssECI	CCNNGG	2 cut(s)	37, 38
BssMI	GATC	4 cut(s)	71, 99, 155, 183
Bst2UI	CCWGG	2 cut(s)	39, 91
BstKTI	GATC	4 cut(s)	74, 102, 158, 186
BstMBI	GATC	4 cut(s)	71, 99, 155, 183
BstNI	CCWGG	2 cut(s)	39, 91
BstSCI	CCNGG	2 cut(s)	37, 89
Cfr13I	GGNCC	2 cut(s)	93, 177
CviAII	CATG	2 cut(s)	97, 181
CviJI	RGCY	3 cut(s)	77, 161, 245
CviKI_1	RGCY	3 cut(s)	77, 161, 245
DpnI	GATC	4 cut(s)	73, 101, 157, 185
DpnII	GATC	4 cut(s)	71, 99, 155, 183
Eco47I	GGWCC	2 cut(s)	93, 177
EcoRI	GAATTC	2 cut(s)	54, 138
EcoRII	CCWGG	2 cut(s)	37, 89
FaeI	CATG	2 cut(s)	100, 184
FaiI	YATR	7 cut(s)	98, 129, 182, 213, 219, 221, 236
FatI	CATG	2 cut(s)	96, 180
FbaI	TGATCA	2 cut(s)	99, 183
FspBI	CTAG	1 cut(s)	174
Hin1II	CATG	2 cut(s)	100, 184
HphI	GGTGA	1 cut(s)	145
HpyCH4V	TGCA	1 cut(s)	4
Hsp92II	CATG	2 cut(s)	100, 184
Ksp22I	TGATCA	2 cut(s)	99, 183
Kzo9I	GATC	4 cut(s)	71, 99, 155, 183
LpnPI	CCDG	8 cut(s)	24, 51, 53, 63, 76, 103, 137, 147
MaeI	CTAG	1 cut(s)	174
MalI	GATC	4 cut(s)	73, 101, 157, 185
MboI	GATC	4 cut(s)	71, 99, 155, 183
MboII	GAAGA	1 cut(s)	19
MfeI	CAATTG	3 cut(s)	59, 143, 239
MluCI	AATT	5 cut(s)	54, 59, 138, 143, 239
MnlI	CCTC	4 cut(s)	100, 103, 184, 187
MseI	TTAA	1 cut(s)	247
MspA1I	CMGCKG	2 cut(s)	77, 161
MspR9I	CCNGG	2 cut(s)	39, 91
MunI	CAATTG	3 cut(s)	59, 143, 239
MvaI	CCWGG	2 cut(s)	39, 91
NdeII	GATC	4 cut(s)	71, 99, 155, 183
NlaIII	CATG	2 cut(s)	100, 184
PasI	CCCWGGG	1 cut(s)	38
Psp6I	CCWGG	2 cut(s)	37, 89
PspGI	CCWGG	2 cut(s)	37, 89
PspPI	GGNCC	2 cut(s)	93, 177
PvuII	CAGCTG	2 cut(s)	77, 161
SaqAI	TTAA	1 cut(s)	247
Sau3AI	GATC	4 cut(s)	71, 99, 155, 183
Sau96I	GGNCC	2 cut(s)	93, 177
ScrFI	CCNGG	2 cut(s)	39, 91
SetI	ASST	3 cut(s)	79, 135, 163
SinI	GGWCC	2 cut(s)	93, 177
Sse9I	AATT	5 cut(s)	54, 59, 138, 143, 239
SspMI	CTAG	1 cut(s)	174
StyD4I	CCNGG	2 cut(s)	37, 89
TasI	AATT	5 cut(s)	54, 59, 138, 143, 239
Tru1I	TTAA	1 cut(s)	247
Tru9I	TTAA	1 cut(s)	247
TspDTI	ATGAA	2 cut(s)	111, 195
VpaK11BI	GGWCC	2 cut(s)	93, 177
XapI	RAATTY	2 cut(s)	54, 138
XspI	CTAG	1 cut(s)	174

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.