Rroxscaffold_3G00224270

Belongs to the mitochondrial carrier (TC 2.A.29) family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
7379002 .. 7381056
2055 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00224270.1

Sequence Viewer

Length: 180 bp
ATGATCAAGGTGAGAATTCAATTGGATTGGGGATCAGCTGGACAACCTGCCAGGATCTTGATCAAGGAGGAGGGTTTTGGTTCATTGTATAAGTTGGACAAGCTGCAGAGTAATGTTCTGTGGTATTCTGTTATGAAGTTTGCTCATTTCTTTGGTAAAATCCATCTTCAATACTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.91

Weight (kDa)

9.7

Isoelectric Point (pI)

32.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 178
Acc36I ACCTGC 1 cut(s) 55
AclWI GGATC 2 cut(s) 40, 62
AcsI RAATTY 1 cut(s) 15
AgsI TTSAA 2 cut(s) 20, 170
AjnI CCWGG 1 cut(s) 50
AluBI AGCT 2 cut(s) 38, 103
AluI AGCT 2 cut(s) 38, 103
AlwI GGATC 2 cut(s) 40, 62
ApeKI GCWGC 1 cut(s) 103
ApoI RAATTY 1 cut(s) 15
AsuHPI GGTGA 1 cut(s) 22
BbvI GCAGC 1 cut(s) 90
BccI CCATC 1 cut(s) 171
BciT130I CCWGG 1 cut(s) 52
BclI TGATCA 2 cut(s) 3, 60
BfmI CTRYAG 1 cut(s) 104
BfuAI ACCTGC 1 cut(s) 55
BisI GCNGC 1 cut(s) 104
BlsI GCNGC 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 52
BmrFI CCNGG 1 cut(s) 52
BsaBI GATNNNNATC 1 cut(s) 59
Bse8I GATNNNNATC 1 cut(s) 59
BseBI CCWGG 1 cut(s) 52
BseJI GATNNNNATC 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 90
Bsp143I GATC 4 cut(s) 3, 32, 54, 60
BspMAI CTGCAG 1 cut(s) 108
BspMI ACCTGC 1 cut(s) 55
BspPI GGATC 2 cut(s) 40, 62
BssMI GATC 4 cut(s) 3, 32, 54, 60
Bst2UI CCWGG 1 cut(s) 52
BstKTI GATC 4 cut(s) 6, 35, 57, 63
BstMBI GATC 4 cut(s) 3, 32, 54, 60
BstNI CCWGG 1 cut(s) 52
BstSCI CCNGG 1 cut(s) 50
BstSFI CTRYAG 1 cut(s) 104
BstV1I GCAGC 1 cut(s) 90
BstX2I RGATCY 1 cut(s) 54
BstYI RGATCY 1 cut(s) 54
BveI ACCTGC 1 cut(s) 55
CviJI RGCY 2 cut(s) 38, 103
CviKI_1 RGCY 2 cut(s) 38, 103
DpnI GATC 4 cut(s) 5, 34, 56, 62
DpnII GATC 4 cut(s) 3, 32, 54, 60
EcoRI GAATTC 1 cut(s) 15
EcoRII CCWGG 1 cut(s) 50
FaiI YATR 3 cut(s) 90, 134, 178
FbaI TGATCA 2 cut(s) 3, 60
Fnu4HI GCNGC 1 cut(s) 104
Fsp4HI GCNGC 1 cut(s) 104
GluI GCNGC 1 cut(s) 104
HphI GGTGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 106
Ksp22I TGATCA 2 cut(s) 3, 60
Kzo9I GATC 4 cut(s) 3, 32, 54, 60
LpnPI CCDG 4 cut(s) 24, 37, 60, 64
Lsp1109I GCAGC 1 cut(s) 90
MalI GATC 4 cut(s) 5, 34, 56, 62
MboI GATC 4 cut(s) 3, 32, 54, 60
MboII GAAGA 1 cut(s) 158
MfeI CAATTG 1 cut(s) 20
MflI RGATCY 1 cut(s) 54
MluCI AATT 2 cut(s) 15, 20
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 2 cut(s) 61, 64
MspA1I CMGCKG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 52
MunI CAATTG 1 cut(s) 20
MvaI CCWGG 1 cut(s) 52
NdeII GATC 4 cut(s) 3, 32, 54, 60
PkrI GCNGC 1 cut(s) 105
PsiI TTATAA 1 cut(s) 178
Psp6I CCWGG 1 cut(s) 50
PspGI CCWGG 1 cut(s) 50
PstI CTGCAG 1 cut(s) 108
PsuI RGATCY 1 cut(s) 54
PvuII CAGCTG 1 cut(s) 38
SatI GCNGC 1 cut(s) 104
Sau3AI GATC 4 cut(s) 3, 32, 54, 60
ScrFI CCNGG 1 cut(s) 52
SetI ASST 4 cut(s) 12, 40, 49, 105
SfcI CTRYAG 1 cut(s) 104
SgeI CNNG 8 cut(s) 19, 51, 59, 63, 64, 70, 76, 112
Sse9I AATT 2 cut(s) 15, 20
StyD4I CCNGG 1 cut(s) 50
TasI AATT 2 cut(s) 15, 20
TseI GCWGC 1 cut(s) 103
TspDTI ATGAA 2 cut(s) 72, 149
XapI RAATTY 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.