Rroxscaffold_3G00226840

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
10643601 .. 10647835
4235 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00226840.1

Sequence Viewer

Length: 165 bp
ATGCGGGGGCTAATGATAAGGAAGAATCCCCATCAAAAGCCTATGAGTTGGCAGCACTCAAGTCGTGAGGAACATCAACTTTTACAAAATTTTCCGGTCTCTGATTATGAGAATGAAATTGATCTGTTGAACACTAACAAAAACAAGAGTACTTGGCCTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.52

Weight (kDa)

8.2

Isoelectric Point (pI)

37.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 4
AcsI RAATTY 1 cut(s) 88
AfaI GTAC 1 cut(s) 151
AgsI TTSAA 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 103
AoxI GGCC 1 cut(s) 155
ApeKI GCWGC 1 cut(s) 52
ApoI RAATTY 1 cut(s) 88
BbvI GCAGC 1 cut(s) 64
BccI CCATC 1 cut(s) 39
BcgI CGANNNNNNTGC 2 cut(s) 44, 78
BcoDI GTCTC 1 cut(s) 103
BisI GCNGC 1 cut(s) 53
BlsI GCNGC 1 cut(s) 54
BmcAI AGTACT 1 cut(s) 151
BpuEI CTTGAG 1 cut(s) 43
BsaI GGTCTC 1 cut(s) 103
BsaWI WCCGGW 1 cut(s) 94
BseXI GCAGC 1 cut(s) 64
BshFI GGCC 1 cut(s) 157
BsiSI CCGG 1 cut(s) 95
BsmAI GTCTC 1 cut(s) 103
BsnI GGCC 1 cut(s) 157
Bso31I GGTCTC 1 cut(s) 103
Bsp143I GATC 1 cut(s) 121
BspACI CCGC 1 cut(s) 4
BspANI GGCC 1 cut(s) 157
BspTNI GGTCTC 1 cut(s) 103
BssMI GATC 1 cut(s) 121
BstKTI GATC 1 cut(s) 124
BstMAI GTCTC 1 cut(s) 103
BstMBI GATC 1 cut(s) 121
BstV1I GCAGC 1 cut(s) 64
BsuRI GGCC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 150
CviJI RGCY 3 cut(s) 10, 40, 157
CviKI_1 RGCY 3 cut(s) 10, 40, 157
CviQI GTAC 1 cut(s) 150
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eco31I GGTCTC 1 cut(s) 103
FaiI YATR 2 cut(s) 44, 108
Fnu4HI GCNGC 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 53
GluI GCNGC 1 cut(s) 53
HaeIII GGCC 1 cut(s) 157
HapII CCGG 1 cut(s) 95
HinfI GANTC 1 cut(s) 25
HpaII CCGG 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 65
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 1 cut(s) 108
Lsp1109I GCAGC 1 cut(s) 64
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 1 cut(s) 34
MluCI AATT 2 cut(s) 88, 117
MnlI CCTC 1 cut(s) 61
MspI CCGG 1 cut(s) 95
NdeII GATC 1 cut(s) 121
PfeI GAWTC 1 cut(s) 25
PkrI GCNGC 1 cut(s) 54
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SatI GCNGC 1 cut(s) 53
Sau3AI GATC 1 cut(s) 121
ScaI AGTACT 1 cut(s) 151
SgeI CNNG 5 cut(s) 17, 72, 77, 107, 157
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 2 cut(s) 88, 117
SsiI CCGC 1 cut(s) 4
TasI AATT 2 cut(s) 88, 117
TatI WGTACW 1 cut(s) 149
TfiI GAWTC 1 cut(s) 25
TseI GCWGC 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 129
XapI RAATTY 1 cut(s) 88
ZrmI AGTACT 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.