Rroxscaffold_3G00236610

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
23985814 .. 23990210
4397 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00236610.1

Sequence Viewer

Length: 210 bp
ATGAGGGATGACTTGCCACTCAAGGCTTCCTCCTCACAAGCAAAGATATGTTTTATAAAGCCTACTCCAAGTTCAAGATACCTTCCAACTTTAAGAATCGAGATGCTTAAAACTTTAAAAGTGCCTTATTTACTGTTAGTATTCTTAATAATTCATACTCTACTCTCTTCAATAGAACTGCATAGGTGCCAAAATGAAAACCAACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.98

Weight (kDa)

9.44

Isoelectric Point (pI)

41.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 56
AccB1I GGYRCC 1 cut(s) 186
AgsI TTSAA 2 cut(s) 75, 171
BanI GGYRCC 1 cut(s) 186
BmiI GGNNCC 1 cut(s) 188
BmsI GCATC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 5
BseGI GGATG 1 cut(s) 13
BseRI GAGGAG 1 cut(s) 22
BshNI GGYRCC 1 cut(s) 186
BspLI GGNNCC 1 cut(s) 188
BspT107I GGYRCC 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 172
BstF5I GGATG 1 cut(s) 13
BtsCI GGATG 1 cut(s) 13
CviJI RGCY 2 cut(s) 26, 61
CviKI_1 RGCY 2 cut(s) 26, 61
DraI TTTAAA 1 cut(s) 117
Eam1104I CTCTTC 1 cut(s) 172
EarI CTCTTC 1 cut(s) 172
FaiI YATR 4 cut(s) 49, 56, 156, 183
FokI GGATG 1 cut(s) 20
HinfI GANTC 1 cut(s) 96
Hpy188III TCNNGA 2 cut(s) 75, 100
HpyAV CCTTC 1 cut(s) 92
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 181
LweI GCATC 1 cut(s) 93
MboII GAAGA 1 cut(s) 159
MluCI AATT 1 cut(s) 150
MmeI TCCRAC 1 cut(s) 110
MnlI CCTC 2 cut(s) 40, 43
MseI TTAA 4 cut(s) 92, 108, 116, 146
NlaIV GGNNCC 1 cut(s) 188
PfeI GAWTC 1 cut(s) 96
PsiI TTATAA 1 cut(s) 56
PspN4I GGNNCC 1 cut(s) 188
SaqAI TTAA 4 cut(s) 92, 108, 116, 146
SetI ASST 2 cut(s) 84, 188
SfaNI GCATC 1 cut(s) 93
SgeI CNNG 6 cut(s) 25, 34, 50, 81, 87, 112
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
Sse9I AATT 1 cut(s) 150
TaaI ACNGT 1 cut(s) 135
TaqI TCGA 1 cut(s) 99
TasI AATT 1 cut(s) 150
TfiI GAWTC 1 cut(s) 96
Tru1I TTAA 4 cut(s) 92, 108, 116, 146
Tru9I TTAA 4 cut(s) 92, 108, 116, 146
TspDTI ATGAA 2 cut(s) 143, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.