Rroxscaffold_4G00305750

L-threonine ammonia-lyase activity

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
26399527 .. 26402325
2799 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00305750.1

Sequence Viewer

Length: 192 bp
ATGGTAAAATTGAAGGAGGCAGGGAAGCCTTCGTCGCCACCTAGTGTTTCTGGCGAACTGTCGCACCTGGAATTTGAACTTCAAATTTATCATGATGAGACCAACGCTTGCTTAGACGAGATGCAAGCTTCTATCCAGGATTCACTTGCCACCTCTTTGGCAATTAAGCTTCCGCTCTATGCTCATGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

63

Amino Acids

6.84

Weight (kDa)

4.84

Isoelectric Point (pI)

42.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 175
AciI CCGC 1 cut(s) 173
AcsI RAATTY 2 cut(s) 71, 84
AdeI CACNNNGTG 1 cut(s) 44
AgsI TTSAA 3 cut(s) 13, 77, 83
AjnI CCWGG 2 cut(s) 66, 135
AluBI AGCT 2 cut(s) 128, 169
AluI AGCT 2 cut(s) 128, 169
Alw26I GTCTC 1 cut(s) 92
ApoI RAATTY 2 cut(s) 71, 84
BciT130I CCWGG 2 cut(s) 68, 137
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 42
Bme1390I CCNGG 2 cut(s) 68, 137
BmrFI CCNGG 2 cut(s) 68, 137
BmsI GCATC 1 cut(s) 111
BsaI GGTCTC 1 cut(s) 92
BseBI CCWGG 2 cut(s) 68, 137
BsmAI GTCTC 1 cut(s) 92
Bso31I GGTCTC 1 cut(s) 92
BspACI CCGC 1 cut(s) 173
BspHI TCATGA 1 cut(s) 91
BspTNI GGTCTC 1 cut(s) 92
BsrBI CCGCTC 1 cut(s) 175
Bst2UI CCWGG 2 cut(s) 68, 137
Bst4CI ACNGT 1 cut(s) 60
BstC8I GCNNGC 2 cut(s) 109, 126
BstDEI CTNAG 1 cut(s) 112
BstMAI GTCTC 1 cut(s) 92
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstNI CCWGG 2 cut(s) 68, 137
BstSCI CCNGG 2 cut(s) 66, 135
BstXI CCANNNNNNTGG 1 cut(s) 157
Cac8I GCNNGC 2 cut(s) 109, 126
CciI TCATGA 1 cut(s) 91
CviAII CATG 2 cut(s) 92, 185
CviJI RGCY 3 cut(s) 28, 128, 169
CviKI_1 RGCY 3 cut(s) 28, 128, 169
DdeI CTNAG 1 cut(s) 112
DraIII CACNNNGTG 1 cut(s) 44
Eco31I GGTCTC 1 cut(s) 92
EcoRII CCWGG 2 cut(s) 66, 135
FaeI CATG 2 cut(s) 95, 188
FaiI YATR 3 cut(s) 93, 180, 186
FatI CATG 2 cut(s) 91, 184
FspBI CTAG 1 cut(s) 42
Hin1II CATG 2 cut(s) 95, 188
HindIII AAGCTT 2 cut(s) 126, 167
HinfI GANTC 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 92
Hpy99I CGWCG 1 cut(s) 37
HpyAV CCTTC 2 cut(s) 7, 39
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 1 cut(s) 112
Hsp92II CATG 2 cut(s) 95, 188
LpnPI CCDG 6 cut(s) 6, 36, 53, 80, 122, 149
LweI GCATC 1 cut(s) 111
MaeI CTAG 1 cut(s) 42
MbiI CCGCTC 1 cut(s) 175
MluCI AATT 4 cut(s) 8, 71, 84, 162
MnlI CCTC 2 cut(s) 10, 163
MseI TTAA 1 cut(s) 165
MspR9I CCNGG 2 cut(s) 68, 137
MvaI CCWGG 2 cut(s) 68, 137
MwoI GCNNNNNNNGC 1 cut(s) 34
NlaIII CATG 2 cut(s) 95, 188
PagI TCATGA 1 cut(s) 91
PfeI GAWTC 1 cut(s) 140
PfoI TCCNGGA 1 cut(s) 135
Psp6I CCWGG 2 cut(s) 66, 135
PspGI CCWGG 2 cut(s) 66, 135
SaqAI TTAA 1 cut(s) 165
ScrFI CCNGG 2 cut(s) 68, 137
SetI ASST 5 cut(s) 43, 69, 130, 155, 171
SfaNI GCATC 1 cut(s) 111
Sse9I AATT 4 cut(s) 8, 71, 84, 162
SsiI CCGC 1 cut(s) 173
SspMI CTAG 1 cut(s) 42
StyD4I CCNGG 2 cut(s) 66, 135
TaaI ACNGT 1 cut(s) 60
TasI AATT 4 cut(s) 8, 71, 84, 162
TfiI GAWTC 1 cut(s) 140
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
XapI RAATTY 2 cut(s) 71, 84
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.