Rh4CG084100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
15246622 .. 15246852
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG084100.1

Sequence Viewer

Length: 231 bp
ATGGTTACTAGTTGTGTTAGTAATACGGCTATGACTATGGTTGAACGTGCTGTGAGTGAAGCACAAACAAACCCATTGCAATATGCTGGGTTTGGCCCTCCTACTAATACTAGCACTGGATTGTTCAATGGTCAGATCCACTCGCACTTACACCAGTCCCAAGCCTCTTATCAGATGCAAATGGATCCTAATCCTTTCACGATGACTTACTCGGGTCCTTATGAGGCTACG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.39

Weight (kDa)

5.25

Isoelectric Point (pI)

23.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 130, 179, 192
AgsI TTSAA 2 cut(s) 44, 127
AhlI ACTAGT 1 cut(s) 8
AlwI GGATC 3 cut(s) 130, 179, 192
Ama87I CYCGRG 1 cut(s) 211
AoxI GGCC 1 cut(s) 94
AspS9I GGNCC 2 cut(s) 95, 215
AvaI CYCGRG 1 cut(s) 211
AvaII GGWCC 1 cut(s) 215
BamHI GGATCC 1 cut(s) 184
BceAI ACGGC 1 cut(s) 42
BcuI ACTAGT 1 cut(s) 8
BfaI CTAG 2 cut(s) 9, 111
Bme18I GGWCC 1 cut(s) 215
BmeT110I CYCGRG 1 cut(s) 211
BmgT120I GGNCC 2 cut(s) 95, 215
BmiI GGNNCC 2 cut(s) 186, 216
BmsI GCATC 1 cut(s) 165
BsaBI GATNNNNATC 1 cut(s) 189
Bse1I ACTGG 2 cut(s) 121, 154
Bse3DI GCAATG 1 cut(s) 74
Bse8I GATNNNNATC 1 cut(s) 189
BseJI GATNNNNATC 1 cut(s) 189
BseMI GCAATG 1 cut(s) 74
BseNI ACTGG 2 cut(s) 121, 154
BseYI CCCAGC 1 cut(s) 86
BshFI GGCC 1 cut(s) 96
BsiHKCI CYCGRG 1 cut(s) 211
BslFI GGGAC 1 cut(s) 142
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 1 cut(s) 96
BsoBI CYCGRG 1 cut(s) 211
Bsp143I GATC 2 cut(s) 135, 184
BspANI GGCC 1 cut(s) 96
BspLI GGNNCC 2 cut(s) 186, 216
BspPI GGATC 3 cut(s) 130, 179, 192
BsrDI GCAATG 1 cut(s) 74
BsrI ACTGG 2 cut(s) 121, 154
BssMI GATC 2 cut(s) 135, 184
BstKTI GATC 2 cut(s) 138, 187
BstMBI GATC 2 cut(s) 135, 184
BstX2I RGATCY 2 cut(s) 135, 184
BstYI RGATCY 2 cut(s) 135, 184
BsuRI GGCC 1 cut(s) 96
BtsIMutI CAGTG 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 95, 215
CviJI RGCY 4 cut(s) 29, 96, 164, 227
CviKI_1 RGCY 4 cut(s) 29, 96, 164, 227
DpnI GATC 2 cut(s) 137, 186
DpnII GATC 2 cut(s) 135, 184
Eco47I GGWCC 1 cut(s) 215
Eco88I CYCGRG 1 cut(s) 211
EcoO109I RGGNCCY 1 cut(s) 215
FaiI YATR 4 cut(s) 32, 38, 84, 222
FaqI GGGAC 1 cut(s) 142
FspBI CTAG 2 cut(s) 9, 111
GsaI CCCAGC 1 cut(s) 90
HaeIII GGCC 1 cut(s) 96
Hpy188I TCNGA 2 cut(s) 135, 174
Hpy188III TCNNGA 1 cut(s) 199
HpyCH4IV ACGT 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 79, 178
HpySE526I ACGT 1 cut(s) 46
Kzo9I GATC 2 cut(s) 135, 184
LpnPI CCDG 3 cut(s) 72, 102, 167
LweI GCATC 1 cut(s) 165
MaeI CTAG 2 cut(s) 9, 111
MaeII ACGT 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 4
MalI GATC 2 cut(s) 137, 186
MboI GATC 2 cut(s) 135, 184
MflI RGATCY 2 cut(s) 135, 184
MnlI CCTC 3 cut(s) 108, 175, 217
NdeII GATC 2 cut(s) 135, 184
NlaIV GGNNCC 2 cut(s) 186, 216
PpuMI RGGWCCY 1 cut(s) 215
Psp5II RGGWCCY 1 cut(s) 215
PspFI CCCAGC 1 cut(s) 86
PspN4I GGNNCC 2 cut(s) 186, 216
PspPI GGNCC 2 cut(s) 95, 215
PspPPI RGGWCCY 1 cut(s) 215
PsuI RGATCY 2 cut(s) 135, 184
Sau3AI GATC 2 cut(s) 135, 184
Sau96I GGNCC 2 cut(s) 95, 215
SetI ASST 1 cut(s) 49
SfaNI GCATC 1 cut(s) 165
SinI GGWCC 1 cut(s) 215
SpeI ACTAGT 1 cut(s) 8
SspMI CTAG 2 cut(s) 9, 111
TaiI ACGT 1 cut(s) 49
TscAI CASTG 1 cut(s) 121
TspRI CASTG 1 cut(s) 121
VpaK11BI GGWCC 1 cut(s) 215
XspI CTAG 2 cut(s) 9, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.