Rh6CG309200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
49144673 .. 49144993
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG309200.1

Sequence Viewer

Length: 321 bp
ATGGAGGATACATCATCCACTATGGCCAGATCTAAGGGTAATCCAACTCATACCTCAAGATCTGAGGGTAATCCCACTCATACCTCATCTTTTCCTGATTTTAACTTTACTACTGATGATGTGTTGTTACAATTAACTAGTACTGTGCGTACTAGTTCTATTGAGGTCACCACTGAGTTAAAAATTACGGGAAATGATGCTGAGAAAATGGAGTTCAAGGAGACAGGAATGATTGGAAATATGGGGGTTAAACCTATAGGTAGTGGTAGTACTATGGCCTTAGCAAGTAGTTCAGTAAATGGATCATTAAGTGCCTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.16

Weight (kDa)

4.97

Isoelectric Point (pI)

35.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 310
AcoI YGGCCR 1 cut(s) 24
AfaI GTAC 3 cut(s) 142, 151, 271
AgsI TTSAA 1 cut(s) 217
AhlI ACTAGT 2 cut(s) 137, 152
Alw26I GTCTC 1 cut(s) 215
AlwI GGATC 1 cut(s) 310
AoxI GGCC 2 cut(s) 24, 276
AsuHPI GGTGA 1 cut(s) 160
BalI TGGCCA 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 215
BcuI ACTAGT 2 cut(s) 137, 152
BfaI CTAG 2 cut(s) 138, 153
BfmI CTRYAG 1 cut(s) 255
BglII AGATCT 2 cut(s) 29, 59
BmcAI AGTACT 2 cut(s) 142, 271
BmsI GCATC 1 cut(s) 187
Bpu10I CCTNAGC 1 cut(s) 280
BpuEI CTTGAG 1 cut(s) 40
BseGI GGATG 1 cut(s) 14
BseMII CTCAG 3 cut(s) 54, 165, 192
BshFI GGCC 2 cut(s) 26, 278
BsmAI GTCTC 1 cut(s) 215
BsnI GGCC 2 cut(s) 26, 278
Bsp143I GATC 3 cut(s) 29, 59, 302
BspANI GGCC 2 cut(s) 26, 278
BspCNI CTCAG 3 cut(s) 55, 166, 193
BspPI GGATC 1 cut(s) 310
BssMI GATC 3 cut(s) 29, 59, 302
Bst4CI ACNGT 1 cut(s) 145
BstDEI CTNAG 5 cut(s) 33, 63, 174, 201, 280
BstEII GGTNACC 1 cut(s) 166
BstF5I GGATG 1 cut(s) 14
BstKTI GATC 3 cut(s) 32, 62, 305
BstMAI GTCTC 1 cut(s) 215
BstMBI GATC 3 cut(s) 29, 59, 302
BstPI GGTNACC 1 cut(s) 166
BstSFI CTRYAG 1 cut(s) 255
BstX2I RGATCY 2 cut(s) 29, 59
BstYI RGATCY 2 cut(s) 29, 59
BsuRI GGCC 2 cut(s) 26, 278
BtsCI GGATG 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 171
Csp6I GTAC 3 cut(s) 141, 150, 270
CviJI RGCY 2 cut(s) 26, 278
CviKI_1 RGCY 2 cut(s) 26, 278
CviQI GTAC 3 cut(s) 141, 150, 270
DdeI CTNAG 5 cut(s) 33, 63, 174, 201, 280
DpnI GATC 3 cut(s) 31, 61, 304
DpnII GATC 3 cut(s) 29, 59, 302
EaeI YGGCCR 1 cut(s) 24
Eco91I GGTNACC 1 cut(s) 166
EcoO65I GGTNACC 1 cut(s) 166
FaiI YATR 6 cut(s) 23, 51, 81, 242, 257, 275
FspBI CTAG 2 cut(s) 138, 153
HaeIII GGCC 2 cut(s) 26, 278
HphI GGTGA 1 cut(s) 160
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 2 cut(s) 57, 95
HpyCH4III ACNGT 1 cut(s) 145
HpyF3I CTNAG 5 cut(s) 33, 63, 174, 201, 280
Kzo9I GATC 3 cut(s) 29, 59, 302
LpnPI CCDG 3 cut(s) 40, 108, 210
LweI GCATC 1 cut(s) 187
MaeI CTAG 2 cut(s) 138, 153
MaeIII GTNAC 2 cut(s) 126, 166
MalI GATC 3 cut(s) 31, 61, 304
MboI GATC 3 cut(s) 29, 59, 302
MflI RGATCY 2 cut(s) 29, 59
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 2 cut(s) 131, 183
MluNI TGGCCA 1 cut(s) 26
MmeI TCCRAC 1 cut(s) 68
MnlI CCTC 4 cut(s) 58, 64, 94, 157
Mox20I TGGCCA 1 cut(s) 26
MscI TGGCCA 1 cut(s) 26
MseI TTAA 5 cut(s) 102, 134, 179, 249, 308
Msp20I TGGCCA 1 cut(s) 26
NdeII GATC 3 cut(s) 29, 59, 302
NmuCI GTSAC 1 cut(s) 166
PspEI GGTNACC 1 cut(s) 166
PsuI RGATCY 2 cut(s) 29, 59
RsaI GTAC 3 cut(s) 142, 151, 271
RsaNI GTAC 3 cut(s) 141, 150, 270
SaqAI TTAA 5 cut(s) 102, 134, 179, 249, 308
Sau3AI GATC 3 cut(s) 29, 59, 302
ScaI AGTACT 2 cut(s) 142, 271
SetI ASST 5 cut(s) 56, 86, 168, 256, 262
SfaNI GCATC 1 cut(s) 187
SfcI CTRYAG 1 cut(s) 255
SgeI CNNG 9 cut(s) 39, 69, 107, 150, 165, 201, 229, 237, 297
SmlI CTYRAG 1 cut(s) 55
SmoI CTYRAG 1 cut(s) 55
SpeI ACTAGT 2 cut(s) 137, 152
Sse9I AATT 2 cut(s) 131, 183
SspMI CTAG 2 cut(s) 138, 153
TaaI ACNGT 1 cut(s) 145
TasI AATT 2 cut(s) 131, 183
TatI WGTACW 2 cut(s) 140, 269
Tru1I TTAA 5 cut(s) 102, 134, 179, 249, 308
Tru9I TTAA 5 cut(s) 102, 134, 179, 249, 308
TscAI CASTG 1 cut(s) 178
TseFI GTSAC 1 cut(s) 166
Tsp45I GTSAC 1 cut(s) 166
TspRI CASTG 1 cut(s) 178
XspI CTAG 2 cut(s) 138, 153
ZrmI AGTACT 2 cut(s) 142, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.