Rh2AG243500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
26772409 .. 26772783
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG243500.1

Sequence Viewer

Length: 375 bp
ATGGAGTTCAAGGAGACAGGAATGATTGCAAATATGGGGCCTAAACCTATAGGTAGTGGTAGTACTATGGCTTTAGCAAGTAGTACAGTGAGTGGATCATTAAGTGGAGCACCACCTCAATTCTTCCAGCAACCCAATTTTGGATCCCAACCATATCATACCACTATAGGTTCGAGCTGCATGGGATTTTCTCATTCTCAACCACAGCCATCCCTTAAGCATACTCAGATCCCAAATGACCGTAACTCTTTTGTGATGACATACTCTGGCCCTTATTCGGCTACAATGCATGACTTTCCTAGAAACACTGCTGCACATTTGAATTTTGTGGCACCTAGTTATACACAAAACCTTAATTACACCACAATTCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

13.38

Weight (kDa)

7.95

Isoelectric Point (pI)

37.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 331
AclWI GGATC 4 cut(s) 103, 138, 151, 223
AcsI RAATTY 1 cut(s) 322
AfaI GTAC 2 cut(s) 64, 85
AfiI CCNNNNNNNGG 2 cut(s) 140, 277
AflII CTTAAG 1 cut(s) 215
AgsI TTSAA 2 cut(s) 10, 322
AluBI AGCT 1 cut(s) 177
AluI AGCT 1 cut(s) 177
Alw21I GWGCWC 1 cut(s) 112
Alw26I GTCTC 1 cut(s) 8
AlwI GGATC 4 cut(s) 103, 138, 151, 223
AoxI GGCC 2 cut(s) 38, 268
ApeKI GCWGC 2 cut(s) 177, 311
ApoI RAATTY 1 cut(s) 322
AspS9I GGNCC 2 cut(s) 38, 269
BamHI GGATCC 1 cut(s) 143
BanI GGYRCC 1 cut(s) 331
Bbv12I GWGCWC 1 cut(s) 112
BbvI GCAGC 2 cut(s) 164, 298
BccI CCATC 1 cut(s) 217
BcoDI GTCTC 1 cut(s) 8
BfaI CTAG 2 cut(s) 300, 336
BfmI CTRYAG 3 cut(s) 48, 165, 371
BfrI CTTAAG 1 cut(s) 215
BisI GCNGC 2 cut(s) 178, 312
BlsI GCNGC 2 cut(s) 179, 313
BmcAI AGTACT 1 cut(s) 64
BmgT120I GGNCC 2 cut(s) 38, 269
BmiI GGNNCC 3 cut(s) 39, 145, 333
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 277
BseGI GGATG 1 cut(s) 209
BseLI CCNNNNNNNGG 2 cut(s) 140, 277
BseMII CTCAG 1 cut(s) 239
BseXI GCAGC 2 cut(s) 164, 298
BsgI GTGCAG 1 cut(s) 297
BshFI GGCC 2 cut(s) 40, 270
BshNI GGYRCC 1 cut(s) 331
BsiHKAI GWGCWC 1 cut(s) 112
BslI CCNNNNNNNGG 2 cut(s) 140, 277
BsmAI GTCTC 1 cut(s) 8
BsnI GGCC 2 cut(s) 40, 270
Bsp1286I GDGCHC 1 cut(s) 112
Bsp143I GATC 3 cut(s) 95, 143, 228
BspANI GGCC 2 cut(s) 40, 270
BspCNI CTCAG 1 cut(s) 238
BspLI GGNNCC 3 cut(s) 39, 145, 333
BspPI GGATC 4 cut(s) 103, 138, 151, 223
BspT107I GGYRCC 1 cut(s) 331
BspTI CTTAAG 1 cut(s) 215
BssMI GATC 3 cut(s) 95, 143, 228
Bst4CI ACNGT 2 cut(s) 88, 242
BstAFI CTTAAG 1 cut(s) 215
BstDEI CTNAG 1 cut(s) 225
BstF5I GGATG 1 cut(s) 209
BstKTI GATC 3 cut(s) 98, 146, 231
BstMAI GTCTC 1 cut(s) 8
BstMBI GATC 3 cut(s) 95, 143, 228
BstSFI CTRYAG 3 cut(s) 48, 165, 371
BstV1I GCAGC 2 cut(s) 164, 298
BstX2I RGATCY 2 cut(s) 143, 228
BstYI RGATCY 2 cut(s) 143, 228
BsuRI GGCC 2 cut(s) 40, 270
BtsCI GGATG 1 cut(s) 209
BtsI GCAGTG 1 cut(s) 306
BtsIMutI CAGTG 2 cut(s) 93, 306
Cfr13I GGNCC 2 cut(s) 38, 269
Csp6I GTAC 2 cut(s) 63, 84
CviAII CATG 2 cut(s) 181, 290
CviJI RGCY 6 cut(s) 40, 71, 177, 208, 270, 281
CviKI_1 RGCY 6 cut(s) 40, 71, 177, 208, 270, 281
CviQI GTAC 2 cut(s) 63, 84
DdeI CTNAG 1 cut(s) 225
DpnI GATC 3 cut(s) 97, 145, 230
DpnII GATC 3 cut(s) 95, 143, 228
EcoO109I RGGNCCY 1 cut(s) 38
EcoT22I ATGCAT 1 cut(s) 291
FaeI CATG 2 cut(s) 184, 293
FatI CATG 2 cut(s) 180, 289
Fnu4HI GCNGC 2 cut(s) 178, 312
FokI GGATG 1 cut(s) 196
Fsp4HI GCNGC 2 cut(s) 178, 312
FspBI CTAG 2 cut(s) 300, 336
GluI GCNGC 2 cut(s) 178, 312
HaeIII GGCC 2 cut(s) 40, 270
Hin1II CATG 2 cut(s) 184, 293
Hpy188I TCNGA 1 cut(s) 228
HpyCH4III ACNGT 2 cut(s) 88, 242
HpyCH4V TGCA 4 cut(s) 29, 180, 289, 314
HpyF3I CTNAG 1 cut(s) 225
Hsp92II CATG 2 cut(s) 184, 293
Kzo9I GATC 3 cut(s) 95, 143, 228
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 3 cut(s) 3, 140, 252
Lsp1109I GCAGC 2 cut(s) 164, 298
MaeI CTAG 2 cut(s) 300, 336
MaeIII GTNAC 1 cut(s) 242
MalI GATC 3 cut(s) 97, 145, 230
MboI GATC 3 cut(s) 95, 143, 228
MboII GAAGA 1 cut(s) 115
MflI RGATCY 2 cut(s) 143, 228
MhlI GDGCHC 1 cut(s) 112
MluCI AATT 5 cut(s) 119, 136, 322, 355, 366
MnlI CCTC 1 cut(s) 126
Mph1103I ATGCAT 1 cut(s) 291
MseI TTAA 3 cut(s) 101, 216, 354
MspCI CTTAAG 1 cut(s) 215
NdeII GATC 3 cut(s) 95, 143, 228
NlaIII CATG 2 cut(s) 184, 293
NlaIV GGNNCC 3 cut(s) 39, 145, 333
NsiI ATGCAT 1 cut(s) 291
PkrI GCNGC 2 cut(s) 179, 313
PspN4I GGNNCC 3 cut(s) 39, 145, 333
PspPI GGNCC 2 cut(s) 38, 269
PsuI RGATCY 2 cut(s) 143, 228
RsaI GTAC 2 cut(s) 64, 85
RsaNI GTAC 2 cut(s) 63, 84
SaqAI TTAA 3 cut(s) 101, 216, 354
SatI GCNGC 2 cut(s) 178, 312
Sau3AI GATC 3 cut(s) 95, 143, 228
Sau96I GGNCC 2 cut(s) 38, 269
ScaI AGTACT 1 cut(s) 64
SduI GDGCHC 1 cut(s) 112
SetI ASST 7 cut(s) 49, 55, 118, 172, 179, 337, 354
SfcI CTRYAG 3 cut(s) 48, 165, 371
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 5 cut(s) 119, 136, 322, 355, 366
SspMI CTAG 2 cut(s) 300, 336
TaaI ACNGT 2 cut(s) 88, 242
TaqI TCGA 1 cut(s) 173
TasI AATT 5 cut(s) 119, 136, 322, 355, 366
TatI WGTACW 2 cut(s) 62, 83
Tru1I TTAA 3 cut(s) 101, 216, 354
Tru9I TTAA 3 cut(s) 101, 216, 354
TscAI CASTG 2 cut(s) 93, 313
TseI GCWGC 2 cut(s) 177, 311
TspRI CASTG 2 cut(s) 93, 313
Vha464I CTTAAG 1 cut(s) 215
XapI RAATTY 1 cut(s) 322
XspI CTAG 2 cut(s) 300, 336
ZrmI AGTACT 1 cut(s) 64
Zsp2I ATGCAT 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.