Rroxscaffold_4G00327170

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
59667853 .. 59670987
3135 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00327170.1

Sequence Viewer

Length: 198 bp
ATGAGTAAAATAGAGGCTGAACTTGAAGCTGAATTTCAAAGGTTGGGGCTAAACAGGAATACTTCTACTTTGGAGAGAGGATTAACTGATCTTGATGAGATCTATCGAGTTTTGGTGAAAATTCCGAGCTTCGAAGCCATTCACAAGCAGGAAAAAATCATTGAAGCTTCCTATGGAGTCATGATTGCTCAAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.42

Weight (kDa)

5.03

Isoelectric Point (pI)

45.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 32, 120
AgsI TTSAA 3 cut(s) 26, 38, 164
AluBI AGCT 3 cut(s) 29, 129, 167
AluI AGCT 3 cut(s) 29, 129, 167
ApoI RAATTY 2 cut(s) 32, 120
Asp700I GAANNNNTTC 1 cut(s) 138
AsuHPI GGTGA 1 cut(s) 127
AsuII TTCGAA 1 cut(s) 132
BglII AGATCT 1 cut(s) 99
Bpu14I TTCGAA 1 cut(s) 132
Bsp119I TTCGAA 1 cut(s) 132
Bsp143I GATC 2 cut(s) 88, 99
BspHI TCATGA 1 cut(s) 180
BspT104I TTCGAA 1 cut(s) 132
BssMI GATC 2 cut(s) 88, 99
BstBI TTCGAA 1 cut(s) 132
BstKTI GATC 2 cut(s) 91, 102
BstMBI GATC 2 cut(s) 88, 99
BstX2I RGATCY 1 cut(s) 99
BstYI RGATCY 1 cut(s) 99
CciI TCATGA 1 cut(s) 180
CviAII CATG 1 cut(s) 181
CviJI RGCY 6 cut(s) 17, 29, 49, 129, 137, 167
CviKI_1 RGCY 6 cut(s) 17, 29, 49, 129, 137, 167
DpnI GATC 2 cut(s) 90, 101
DpnII GATC 2 cut(s) 88, 99
FaeI CATG 1 cut(s) 184
FaiI YATR 2 cut(s) 174, 182
FatI CATG 1 cut(s) 180
Hin1II CATG 1 cut(s) 184
HindIII AAGCTT 1 cut(s) 165
HinfI GANTC 1 cut(s) 177
HphI GGTGA 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 2 cut(s) 92, 181
Hsp92II CATG 1 cut(s) 184
Kzo9I GATC 2 cut(s) 88, 99
LpnPI CCDG 2 cut(s) 40, 134
MalI GATC 2 cut(s) 90, 101
MboI GATC 2 cut(s) 88, 99
MflI RGATCY 1 cut(s) 99
MluCI AATT 2 cut(s) 32, 120
MlyI GAGTC 1 cut(s) 186
MnlI CCTC 2 cut(s) 7, 71
MroXI GAANNNNTTC 1 cut(s) 138
MseI TTAA 1 cut(s) 83
NdeII GATC 2 cut(s) 88, 99
NlaIII CATG 1 cut(s) 184
NspV TTCGAA 1 cut(s) 132
PagI TCATGA 1 cut(s) 180
PdmI GAANNNNTTC 1 cut(s) 138
PleI GAGTC 1 cut(s) 185
PpsI GAGTC 1 cut(s) 185
PsuI RGATCY 1 cut(s) 99
SaqAI TTAA 1 cut(s) 83
Sau3AI GATC 2 cut(s) 88, 99
SchI GAGTC 1 cut(s) 186
SetI ASST 4 cut(s) 31, 44, 131, 169
SfuI TTCGAA 1 cut(s) 132
SgeI CNNG 8 cut(s) 35, 67, 104, 119, 138, 157, 161, 193
Sse9I AATT 2 cut(s) 32, 120
TaqI TCGA 2 cut(s) 106, 132
TasI AATT 2 cut(s) 32, 120
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
XapI RAATTY 2 cut(s) 32, 120
XmnI GAANNNNTTC 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.