Rroxscaffold_7G00189000

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
28777996 .. 28781903
3908 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00189000.1

Sequence Viewer

Length: 177 bp
ATGAGGAATAGAAGAGAAGAAAGCAGAAGATCTATGAGCTGCGGAAACAAGAGAGAAGAAAGAAAAGGCTGGTCTGCTGTAGGAAAAGCGAGGCAACGATTACAGATTCTGCAGACATTGAATCGACATCACTTGTTGACTGCAGAAAGAGAAACTGGAGATTGGGACAAGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.98

Weight (kDa)

11.12

Isoelectric Point (pI)

91.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 42
AgsI TTSAA 1 cut(s) 121
AluBI AGCT 2 cut(s) 39, 172
AluI AGCT 2 cut(s) 39, 172
AlwNI CAGNNNCTG 1 cut(s) 109
ApeKI GCWGC 1 cut(s) 39
BbvI GCAGC 1 cut(s) 26
BfmI CTRYAG 3 cut(s) 78, 110, 141
BglII AGATCT 1 cut(s) 29
BisI GCNGC 1 cut(s) 40
BlsI GCNGC 1 cut(s) 41
BpmI CTGGAG 1 cut(s) 177
Bse1I ACTGG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 160
BseXI GCAGC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 29
BspACI CCGC 1 cut(s) 42
BspMAI CTGCAG 2 cut(s) 114, 145
BsrI ACTGG 1 cut(s) 160
BssMI GATC 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 7
BstKTI GATC 1 cut(s) 32
BstMBI GATC 1 cut(s) 29
BstSFI CTRYAG 3 cut(s) 78, 110, 141
BstV1I GCAGC 1 cut(s) 26
BstX2I RGATCY 1 cut(s) 29
BstYI RGATCY 1 cut(s) 29
CaiI CAGNNNCTG 1 cut(s) 109
CviJI RGCY 3 cut(s) 39, 69, 172
CviKI_1 RGCY 3 cut(s) 39, 69, 172
DpnI GATC 1 cut(s) 31
DpnII GATC 1 cut(s) 29
Eam1104I CTCTTC 1 cut(s) 7
EarI CTCTTC 1 cut(s) 7
FaiI YATR 1 cut(s) 35
Fnu4HI GCNGC 1 cut(s) 40
Fsp4HI GCNGC 1 cut(s) 40
FspEI CC 8 cut(s) 27, 51, 55, 66, 76, 141, 148, 149
GluI GCNGC 1 cut(s) 40
GsuI CTGGAG 1 cut(s) 177
HincII GTYRAC 1 cut(s) 138
HindII GTYRAC 1 cut(s) 138
HindIII AAGCTT 1 cut(s) 170
HinfI GANTC 2 cut(s) 106, 121
Hpy166II GTNNAC 1 cut(s) 138
Hpy8I GTNNAC 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 112, 143
Kzo9I GATC 1 cut(s) 29
LpnPI CCDG 2 cut(s) 55, 141
Lsp1109I GCAGC 1 cut(s) 26
MalI GATC 1 cut(s) 31
MboI GATC 1 cut(s) 29
MboII GAAGA 4 cut(s) 24, 29, 39, 68
MflI RGATCY 1 cut(s) 29
MnlI CCTC 1 cut(s) 84
NdeII GATC 1 cut(s) 29
PfeI GAWTC 2 cut(s) 106, 121
PkrI GCNGC 1 cut(s) 41
PstI CTGCAG 2 cut(s) 114, 145
PstNI CAGNNNCTG 1 cut(s) 109
PsuI RGATCY 1 cut(s) 29
SatI GCNGC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 29
SetI ASST 2 cut(s) 41, 174
SfcI CTRYAG 3 cut(s) 78, 110, 141
SgeI CNNG 5 cut(s) 61, 82, 102, 145, 168
SsiI CCGC 1 cut(s) 42
TaqI TCGA 1 cut(s) 124
TfiI GAWTC 2 cut(s) 106, 121
TseI GCWGC 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.