Rroxscaffold_5G00380650

monooxygenase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
60808648 .. 60809344
697 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00380650.1

Sequence Viewer

Length: 399 bp
ATGGGGCCATTTTATCTCAAGGAAGCCAAAGGTCGATCCCCCATCATCGATGTTGGGACCATCGAAAAGATCAAGAGTGGAGAGATACAGGTTTTGCCATCCATAACAAGCATAGAAGGAAATGAAATCCGGTTTGAGAATGGCTACCTGAAATGTTATCATGCTATAGTATTTGCTACAGGCTATAAAAGCACTGTGCTAAACTGGCTTAAGGACGGAAACAACCTCTTTAATGACAATGGAATGCCGAAGAAAAGTTTCCCTAACCACTGGAAGTCACAAAATGGCCTTTATTGTGTTGGATTCTCAAGACGTGGATTATTTGGCATTTCACAGGATGCACAGAATATAACAAATGATATAAATTCCTCTCTGAATAAGAGCAAAAGAAGGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.85

Weight (kDa)

9.55

Isoelectric Point (pI)

45.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 30
AcsI RAATTY 1 cut(s) 364
AflII CTTAAG 1 cut(s) 209
AjiI CACGTC 1 cut(s) 314
AlwI GGATC 1 cut(s) 30
AoxI GGCC 2 cut(s) 5, 286
ApoI RAATTY 1 cut(s) 364
Asp700I GAANNNNTTC 1 cut(s) 257
AspS9I GGNCC 2 cut(s) 5, 57
AvaII GGWCC 1 cut(s) 57
BccI CCATC 3 cut(s) 50, 68, 106
BfmI CTRYAG 2 cut(s) 165, 177
BfrI CTTAAG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 57
BmgBI CACGTC 1 cut(s) 314
BmgT120I GGNCC 2 cut(s) 5, 57
BmiI GGNNCC 2 cut(s) 6, 58
BmsI GCATC 1 cut(s) 328
BpuEI CTTGAG 1 cut(s) 292
Bsa29I ATCGAT 1 cut(s) 48
BsaWI WCCGGW 1 cut(s) 129
Bse1I ACTGG 2 cut(s) 209, 275
BseCI ATCGAT 1 cut(s) 48
BseGI GGATG 2 cut(s) 98, 343
BseNI ACTGG 2 cut(s) 209, 275
BshFI GGCC 2 cut(s) 7, 288
BshVI ATCGAT 1 cut(s) 48
BsiSI CCGG 1 cut(s) 130
BslFI GGGAC 1 cut(s) 70
BsmFI GGGAC 1 cut(s) 70
BsmI GAATGC 1 cut(s) 249
BsnI GGCC 2 cut(s) 7, 288
Bsp143I GATC 2 cut(s) 35, 69
BspANI GGCC 2 cut(s) 7, 288
BspDI ATCGAT 1 cut(s) 48
BspLI GGNNCC 2 cut(s) 6, 58
BspPI GGATC 1 cut(s) 30
BspTI CTTAAG 1 cut(s) 209
BsrI ACTGG 2 cut(s) 209, 275
BssMI GATC 2 cut(s) 35, 69
Bst4CI ACNGT 1 cut(s) 196
BstAFI CTTAAG 1 cut(s) 209
BstF5I GGATG 2 cut(s) 98, 343
BstKTI GATC 2 cut(s) 38, 72
BstMBI GATC 2 cut(s) 35, 69
BstMWI GCNNNNNNNGC 2 cut(s) 189, 205
BstSFI CTRYAG 2 cut(s) 165, 177
Bsu15I ATCGAT 1 cut(s) 48
BsuRI GGCC 2 cut(s) 7, 288
BsuTUI ATCGAT 1 cut(s) 48
BtrI CACGTC 1 cut(s) 314
BtsCI GGATG 2 cut(s) 98, 343
BtsIMutI CAGTG 2 cut(s) 192, 268
Cfr13I GGNCC 2 cut(s) 5, 57
ClaI ATCGAT 1 cut(s) 48
CviAII CATG 1 cut(s) 161
CviJI RGCY 6 cut(s) 7, 26, 144, 183, 208, 288
CviKI_1 RGCY 6 cut(s) 7, 26, 144, 183, 208, 288
DpnI GATC 2 cut(s) 37, 71
DpnII GATC 2 cut(s) 35, 69
Eco47I GGWCC 1 cut(s) 57
FaeI CATG 1 cut(s) 164
FaiI YATR 8 cut(s) 104, 113, 162, 167, 186, 350, 362, 397
FaqI GGGAC 1 cut(s) 70
FatI CATG 1 cut(s) 160
FokI GGATG 2 cut(s) 85, 350
HaeIII GGCC 2 cut(s) 7, 288
HapII CCGG 1 cut(s) 130
Hin1II CATG 1 cut(s) 164
HinfI GANTC 1 cut(s) 303
HpaII CCGG 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 375
Hpy188III TCNNGA 2 cut(s) 73, 309
HpyAV CCTTC 2 cut(s) 110, 384
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4IV ACGT 1 cut(s) 313
HpyCH4V TGCA 1 cut(s) 341
HpyF10VI GCNNNNNNNGC 2 cut(s) 189, 205
HpySE526I ACGT 1 cut(s) 313
Hsp92II CATG 1 cut(s) 164
Kzo9I GATC 2 cut(s) 35, 69
LpnPI CCDG 7 cut(s) 74, 143, 161, 165, 190, 256, 320
LweI GCATC 1 cut(s) 328
MaeII ACGT 1 cut(s) 313
MaeIII GTNAC 1 cut(s) 276
MalI GATC 2 cut(s) 37, 71
MboI GATC 2 cut(s) 35, 69
MboII GAAGA 1 cut(s) 262
MluCI AATT 1 cut(s) 364
MmeI TCCRAC 1 cut(s) 280
MnlI CCTC 2 cut(s) 236, 379
MroXI GAANNNNTTC 1 cut(s) 257
MseI TTAA 2 cut(s) 210, 231
MspCI CTTAAG 1 cut(s) 209
MspI CCGG 1 cut(s) 130
Mva1269I GAATGC 1 cut(s) 249
MwoI GCNNNNNNNGC 2 cut(s) 189, 205
NdeII GATC 2 cut(s) 35, 69
NlaIII CATG 1 cut(s) 164
NlaIV GGNNCC 2 cut(s) 6, 58
NmuCI GTSAC 1 cut(s) 276
PctI GAATGC 1 cut(s) 249
PdmI GAANNNNTTC 1 cut(s) 257
PfeI GAWTC 1 cut(s) 303
PspN4I GGNNCC 2 cut(s) 6, 58
PspPI GGNCC 2 cut(s) 5, 57
SaqAI TTAA 2 cut(s) 210, 231
Sau3AI GATC 2 cut(s) 35, 69
Sau96I GGNCC 2 cut(s) 5, 57
SetI ASST 5 cut(s) 34, 93, 150, 228, 316
SfaNI GCATC 1 cut(s) 328
SfcI CTRYAG 2 cut(s) 165, 177
SinI GGWCC 1 cut(s) 57
SmlI CTYRAG 3 cut(s) 17, 209, 307
SmoI CTYRAG 3 cut(s) 17, 209, 307
Sse9I AATT 1 cut(s) 364
TaaI ACNGT 1 cut(s) 196
TaiI ACGT 1 cut(s) 316
TaqI TCGA 3 cut(s) 34, 48, 63
TasI AATT 1 cut(s) 364
TfiI GAWTC 1 cut(s) 303
Tru1I TTAA 2 cut(s) 210, 231
Tru9I TTAA 2 cut(s) 210, 231
TscAI CASTG 2 cut(s) 199, 275
TseFI GTSAC 1 cut(s) 276
Tsp45I GTSAC 1 cut(s) 276
TspDTI ATGAA 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 231
TspRI CASTG 2 cut(s) 199, 275
Vha464I CTTAAG 1 cut(s) 209
VpaK11BI GGWCC 1 cut(s) 57
XapI RAATTY 1 cut(s) 364
XmnI GAANNNNTTC 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.