Rorug02G0207500

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
19457188 .. 19457592
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0207500.1

Sequence Viewer

Length: 405 bp
ATGGTGGATTTGGGATATCAAGGTCCTGACTACACTTGGGTTGGTGGTAGAATCAAAGAAAGATTAGATAGAGGTTTTTGTAATGCAGATTGGAGGATGGCTTTTCCTGATGCATTTATCCAACATCTAACCAGATTAAAATTTGATCATTGCCCTGTTTTGTTACAGCTTTTTTCAGGTAGTGTGTCTTTGAATGCTTCCTTGAGGCCGTTCAGATTTCAAGCTATGTGGATGAGCCATGAGCATTATAACGACTTTGTTCGAGATCATTGGGAGGGAGATGGAGGCCACTTACTCAGTAAACTTGGGCATTTATCAAATGCTCTCAAGGAGTGGAATCTCAATGTGTTTGGTAATGTCTTCAGGAAGAAAAAAAGATTATTAGCCAGGCTTAATGGTATCTAG

Protein Analysis

134

Amino Acids

15.65

Weight (kDa)

9.51

Isoelectric Point (pI)

21.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 249
AcsI RAATTY 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 346
AgsI TTSAA 2 cut(s) 193, 221
AjnI CCWGG 1 cut(s) 386
AluBI AGCT 2 cut(s) 169, 224
AluI AGCT 2 cut(s) 169, 224
AoxI GGCC 2 cut(s) 206, 286
ApoI RAATTY 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 23
AvaII GGWCC 1 cut(s) 23
BbsI GAAGAC 1 cut(s) 352
BccI CCATC 2 cut(s) 91, 275
BceAI ACGGC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 388
BclI TGATCA 1 cut(s) 145
BfaI CTAG 1 cut(s) 403
Bme1390I CCNGG 1 cut(s) 388
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 388
BmsI GCATC 1 cut(s) 100
BpiI GAAGAC 1 cut(s) 352
BpuEI CTTGAG 2 cut(s) 223, 311
Bse3DI GCAATG 1 cut(s) 148
BseBI CCWGG 1 cut(s) 388
BseGI GGATG 2 cut(s) 102, 237
BseMI GCAATG 1 cut(s) 148
BseMII CTCAG 1 cut(s) 310
BshFI GGCC 2 cut(s) 208, 288
BsmI GAATGC 1 cut(s) 199
BsnI GGCC 2 cut(s) 208, 288
Bsp143I GATC 2 cut(s) 145, 265
BspANI GGCC 2 cut(s) 208, 288
BspCNI CTCAG 1 cut(s) 309
BsrDI GCAATG 1 cut(s) 148
BssMI GATC 2 cut(s) 145, 265
Bst2UI CCWGG 1 cut(s) 388
BstDEI CTNAG 1 cut(s) 296
BstF5I GGATG 2 cut(s) 102, 237
BstKTI GATC 2 cut(s) 148, 268
BstMBI GATC 2 cut(s) 145, 265
BstNI CCWGG 1 cut(s) 388
BstSCI CCNGG 1 cut(s) 386
BstV2I GAAGAC 1 cut(s) 352
BsuRI GGCC 2 cut(s) 208, 288
BtsCI GGATG 2 cut(s) 102, 237
Cfr13I GGNCC 1 cut(s) 23
CspCI CAANNNNNGTGG 2 cut(s) 209, 244
CviAII CATG 1 cut(s) 239
CviJI RGCY 8 cut(s) 101, 169, 208, 224, 237, 288, 386, 391
CviKI_1 RGCY 8 cut(s) 101, 169, 208, 224, 237, 288, 386, 391
DdeI CTNAG 1 cut(s) 296
DpnI GATC 2 cut(s) 147, 267
DpnII GATC 2 cut(s) 145, 265
Eco32I GATATC 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 23
Eco57I CTGAAG 1 cut(s) 346
EcoO109I RGGNCCY 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 386
EcoRV GATATC 1 cut(s) 17
EcoT22I ATGCAT 1 cut(s) 115
FaeI CATG 1 cut(s) 242
FaiI YATR 3 cut(s) 227, 240, 249
FatI CATG 1 cut(s) 238
FbaI TGATCA 1 cut(s) 145
FokI GGATG 2 cut(s) 109, 244
FspBI CTAG 1 cut(s) 403
HaeIII GGCC 2 cut(s) 208, 288
Hin1II CATG 1 cut(s) 242
HinfI GANTC 2 cut(s) 51, 337
Hpy166II GTNNAC 1 cut(s) 302
Hpy188I TCNGA 1 cut(s) 215
Hpy188III TCNNGA 4 cut(s) 26, 107, 263, 364
Hpy8I GTNNAC 1 cut(s) 302
HpyCH4V TGCA 2 cut(s) 86, 113
HpyF3I CTNAG 1 cut(s) 296
Hsp92II CATG 1 cut(s) 242
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 2 cut(s) 145, 265
LpnPI CCDG 8 cut(s) 39, 120, 145, 162, 168, 349, 373, 400
LweI GCATC 1 cut(s) 100
MaeI CTAG 1 cut(s) 403
MaeIII GTNAC 1 cut(s) 162
MalI GATC 2 cut(s) 147, 267
MboI GATC 2 cut(s) 145, 265
MboII GAAGA 2 cut(s) 352, 379
MluCI AATT 1 cut(s) 140
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 5 cut(s) 65, 87, 198, 268, 278
Mph1103I ATGCAT 1 cut(s) 115
MseI TTAA 2 cut(s) 137, 393
MspR9I CCNGG 1 cut(s) 388
Mva1269I GAATGC 1 cut(s) 199
MvaI CCWGG 1 cut(s) 388
NdeII GATC 2 cut(s) 145, 265
NlaIII CATG 1 cut(s) 242
NsiI ATGCAT 1 cut(s) 115
PctI GAATGC 1 cut(s) 199
PfeI GAWTC 2 cut(s) 51, 337
PpuMI RGGWCCY 1 cut(s) 23
PsiI TTATAA 1 cut(s) 249
Psp5II RGGWCCY 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 386
PspGI CCWGG 1 cut(s) 386
PspPI GGNCC 1 cut(s) 23
PspPPI RGGWCCY 1 cut(s) 23
SaqAI TTAA 2 cut(s) 137, 393
Sau3AI GATC 2 cut(s) 145, 265
Sau96I GGNCC 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 388
SetI ASST 5 cut(s) 25, 76, 171, 181, 226
SfaNI GCATC 1 cut(s) 100
SinI GGWCC 1 cut(s) 23
SmlI CTYRAG 2 cut(s) 202, 326
SmoI CTYRAG 2 cut(s) 202, 326
Sse9I AATT 1 cut(s) 140
SspMI CTAG 1 cut(s) 403
StyD4I CCNGG 1 cut(s) 386
TaqI TCGA 1 cut(s) 262
TasI AATT 1 cut(s) 140
TfiI GAWTC 2 cut(s) 51, 337
Tru1I TTAA 2 cut(s) 137, 393
Tru9I TTAA 2 cut(s) 137, 393
VpaK11BI GGWCC 1 cut(s) 23
XapI RAATTY 1 cut(s) 140
XspI CTAG 1 cut(s) 403
Zsp2I ATGCAT 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.