Rorug03G0227200

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
20889904 .. 20892042
2139 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0227200.1

Sequence Viewer

Length: 249 bp
ATGGAATTTTACAAGGAAATGGTACAGAAGGACATCGGACACCGACAGAAGCCTGAGTTTTCTAAGGTTGAATTGCTCCCAAAAGGCTTGGAGATCCGGTTTCTTTCACAGAAGATTCTGTATGCAAGCAGGTCTGCCATTACCCTGATCCTTTTTAACATTGCACCAGACTTGATGAATCAAGCAAAAGATTATTTGAACAAAACTATGTTTGTTATATTGTTGGCTAGAGTGATTGTTTTAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.6

Weight (kDa)

9.35

Isoelectric Point (pI)

46.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 120
AclWI GGATC 2 cut(s) 88, 142
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 1 cut(s) 24
AgsI TTSAA 2 cut(s) 71, 199
AlwI GGATC 2 cut(s) 88, 142
ApoI RAATTY 1 cut(s) 5
BfaI CTAG 1 cut(s) 228
BfuAI ACCTGC 1 cut(s) 120
BsaWI WCCGGW 1 cut(s) 96
BsaXI ACNNNNNCTCC 2 cut(s) 83, 113
Bse3DI GCAATG 1 cut(s) 159
BseMI GCAATG 1 cut(s) 159
BseMII CTCAG 1 cut(s) 45
BsiSI CCGG 1 cut(s) 97
Bsp143I GATC 2 cut(s) 93, 147
BspCNI CTCAG 1 cut(s) 46
BspMI ACCTGC 1 cut(s) 120
BspPI GGATC 2 cut(s) 88, 142
BsrDI GCAATG 1 cut(s) 159
BssMI GATC 2 cut(s) 93, 147
BstC8I GCNNGC 1 cut(s) 127
BstDEI CTNAG 2 cut(s) 54, 63
BstKTI GATC 2 cut(s) 96, 150
BstMBI GATC 2 cut(s) 93, 147
BstX2I RGATCY 1 cut(s) 93
BstYI RGATCY 1 cut(s) 93
BveI ACCTGC 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 127
Csp6I GTAC 1 cut(s) 23
CviJI RGCY 3 cut(s) 52, 87, 227
CviKI_1 RGCY 3 cut(s) 52, 87, 227
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 2 cut(s) 54, 63
DpnI GATC 2 cut(s) 95, 149
DpnII GATC 2 cut(s) 93, 147
FaiI YATR 3 cut(s) 123, 209, 218
FspBI CTAG 1 cut(s) 228
HapII CCGG 1 cut(s) 97
HinfI GANTC 2 cut(s) 115, 178
HpaII CCGG 1 cut(s) 97
Hpy188I TCNGA 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 22
HpyCH4V TGCA 2 cut(s) 125, 164
HpyF3I CTNAG 2 cut(s) 54, 63
Kzo9I GATC 2 cut(s) 93, 147
LmnI GCTCC 1 cut(s) 81
LpnPI CCDG 5 cut(s) 66, 110, 115, 158, 180
MaeI CTAG 1 cut(s) 228
MalI GATC 2 cut(s) 95, 149
MboI GATC 2 cut(s) 93, 147
MboII GAAGA 1 cut(s) 124
MflI RGATCY 1 cut(s) 93
MluCI AATT 2 cut(s) 5, 71
MseI TTAA 1 cut(s) 156
MspI CCGG 1 cut(s) 97
NdeII GATC 2 cut(s) 93, 147
PfeI GAWTC 2 cut(s) 115, 178
PsuI RGATCY 1 cut(s) 93
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 2 cut(s) 93, 147
SetI ASST 2 cut(s) 69, 134
Sse9I AATT 2 cut(s) 5, 71
SspMI CTAG 1 cut(s) 228
TasI AATT 2 cut(s) 5, 71
TfiI GAWTC 2 cut(s) 115, 178
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 191
XapI RAATTY 1 cut(s) 5
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.