Rorug04G0375100

prefoldin subunit

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
54554768 .. 54555559
792 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0375100.1

Sequence Viewer

Length: 291 bp
ATGGCAAATAATATTGGCCTTAGTTTCTTCCTTCTGGCTCTACTTCTACTTTCAAAGGTGGAAGCAAGACCAATGCCTGCAGCTCCCATTTTGCCTCTATCTGATCCAGATTTTTCATCTTCTTCCATTTCCATAACATCATCATCACCTAATGAAGCAAGCCTGAGTGATATTGATGATGATGATGCTTGCAAGGGTTTAAACAGCAAGGACTGTTTGATGAGAAGGTCGATGGTTGCCCACACAGATTACATCTACACACAGGATATCAGCACTAGTACTGAACCTTGA

Protein Analysis

96

Amino Acids

10.33

Weight (kDa)

4.23

Isoelectric Point (pI)

59.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSK PF06404 11 - 89 2.6e-12 Phytosulfokine precursor protein (PSK)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 98
AfaI GTAC 1 cut(s) 280
AgsI TTSAA 1 cut(s) 54
AhlI ACTAGT 1 cut(s) 275
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AlwI GGATC 1 cut(s) 98
AoxI GGCC 1 cut(s) 16
ApeKI GCWGC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 138
BbvI GCAGC 1 cut(s) 92
BccI CCATC 1 cut(s) 226
BcuI ACTAGT 1 cut(s) 275
BfaI CTAG 1 cut(s) 276
BfmI CTRYAG 1 cut(s) 78
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
BmcAI AGTACT 1 cut(s) 280
BmsI GCATC 1 cut(s) 175
BseMII CTCAG 1 cut(s) 155
BseXI GCAGC 1 cut(s) 92
BshFI GGCC 1 cut(s) 18
BsnI GGCC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 103
BspANI GGCC 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 156
BspMAI CTGCAG 1 cut(s) 82
BspPI GGATC 1 cut(s) 98
BssMI GATC 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 215
BstC8I GCNNGC 3 cut(s) 78, 160, 190
BstDEI CTNAG 2 cut(s) 20, 164
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstSFI CTRYAG 1 cut(s) 78
BstV1I GCAGC 1 cut(s) 92
BsuRI GGCC 1 cut(s) 18
Cac8I GCNNGC 3 cut(s) 78, 160, 190
Csp6I GTAC 1 cut(s) 279
CviJI RGCY 4 cut(s) 18, 38, 83, 162
CviKI_1 RGCY 4 cut(s) 18, 38, 83, 162
CviQI GTAC 1 cut(s) 279
DdeI CTNAG 2 cut(s) 20, 164
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
DraI TTTAAA 1 cut(s) 201
Eco32I GATATC 1 cut(s) 268
EcoRV GATATC 1 cut(s) 268
FaiI YATR 1 cut(s) 134
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 1 cut(s) 276
GluI GCNGC 1 cut(s) 81
HaeIII GGCC 1 cut(s) 18
HphI GGTGA 1 cut(s) 138
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 107
HpyAV CCTTC 2 cut(s) 41, 219
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 80, 192
HpyF3I CTNAG 2 cut(s) 20, 164
Kzo9I GATC 1 cut(s) 103
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 5 cut(s) 20, 90, 120, 176, 248
Lsp1109I GCAGC 1 cut(s) 92
LweI GCATC 1 cut(s) 175
MaeI CTAG 1 cut(s) 276
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 3 cut(s) 19, 111, 114
MnlI CCTC 1 cut(s) 105
MseI TTAA 1 cut(s) 200
MssI GTTTAAAC 1 cut(s) 201
NdeII GATC 1 cut(s) 103
PkrI GCNGC 1 cut(s) 82
PmeI GTTTAAAC 1 cut(s) 201
PstI CTGCAG 1 cut(s) 82
RsaI GTAC 1 cut(s) 280
RsaNI GTAC 1 cut(s) 279
SaqAI TTAA 1 cut(s) 200
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 1 cut(s) 103
ScaI AGTACT 1 cut(s) 280
SetI ASST 5 cut(s) 60, 85, 151, 230, 289
SfaNI GCATC 1 cut(s) 175
SfcI CTRYAG 1 cut(s) 78
SpeI ACTAGT 1 cut(s) 275
SspI AATATT 1 cut(s) 13
SspMI CTAG 1 cut(s) 276
TaaI ACNGT 1 cut(s) 215
TaqI TCGA 1 cut(s) 230
TatI WGTACW 1 cut(s) 278
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 2 cut(s) 105, 168
XspI CTAG 1 cut(s) 276
ZrmI AGTACT 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.