Rorug07G0147200

Nodulin-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
11628482 .. 11634674
6193 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0147200.1

Sequence Viewer

Length: 552 bp
ATGTTCAACAAATTGATTTATTTTTTCTTGTCATGCATGTATGAGTTTATCATGTGTAGCGAATTTAGTATTTTTCTTTCTTTCTTATCAAACAGGGTCAAGAAGGTTGAACCATCGAAAAAGAAAAATGAGAAATCATCTGATAAAGATCAATCAGTACCACAACTATCTCAGGATCAAGAAGCTCAACCATCAAGAAAGAGGAATAAGAAATTGTCTAGTAAGGATCAATCAGTACCTCAACAATCCCAGGATCAAACTAAACCATCAAGAAAGAGAAATACAAGATCGTCTAATAAGGATCAATTATTACCTCAAGCATCTCAGGATCAAACTAAACCATCAAGAAAGAGAAATACAAGATCGTCTAATAAGGATCAATCATTACCTCAAGCATCTCAGAATCAAGAAGCTGAACCTTCAAGAAAGAGAAATAAGAAATCCTCTACAGAGAATCAATCACTACGTCAAGACTCTCAGGATCAAGGAGCTCCACCATCAAGCAAAAGAAAGAAACACTTGTCTACTCGTTTAGTTGGTTATCATACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

21.16

Weight (kDa)

10.22

Isoelectric Point (pI)

93.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 524
AclWI GGATC 7 cut(s) 183, 234, 261, 309, 336, 384, 489
AcsI RAATTY 1 cut(s) 62
AfaI GTAC 2 cut(s) 159, 237
AgsI TTSAA 3 cut(s) 7, 110, 423
AjnI CCWGG 1 cut(s) 249
AluBI AGCT 3 cut(s) 185, 413, 491
AluI AGCT 3 cut(s) 185, 413, 491
Alw21I GWGCWC 1 cut(s) 493
AlwI GGATC 7 cut(s) 183, 234, 261, 309, 336, 384, 489
ApoI RAATTY 1 cut(s) 62
BanII GRGCYC 1 cut(s) 493
Bbv12I GWGCWC 1 cut(s) 493
BccI CCATC 5 cut(s) 121, 199, 274, 349, 505
BciT130I CCWGG 1 cut(s) 251
BfaI CTAG 1 cut(s) 219
BfmI CTRYAG 1 cut(s) 447
Bme1390I CCNGG 1 cut(s) 251
BmrFI CCNGG 1 cut(s) 251
BmsI GCATC 2 cut(s) 329, 404
BpuEI CTTGAG 2 cut(s) 300, 375
BsaBI GATNNNNATC 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 249
Bse8I GATNNNNATC 1 cut(s) 147
BseBI CCWGG 1 cut(s) 251
BseDI CCNNGG 1 cut(s) 249
BseJI GATNNNNATC 1 cut(s) 147
BseMII CTCAG 4 cut(s) 185, 338, 413, 491
BsiHKAI GWGCWC 1 cut(s) 493
Bsp1286I GDGCHC 1 cut(s) 493
BspCNI CTCAG 4 cut(s) 184, 337, 412, 490
BspPI GGATC 7 cut(s) 183, 234, 261, 309, 336, 384, 489
BssECI CCNNGG 1 cut(s) 249
Bst2UI CCWGG 1 cut(s) 251
BstDEI CTNAG 4 cut(s) 171, 324, 399, 477
BstNI CCWGG 1 cut(s) 251
BstNSI RCATGY 1 cut(s) 40
BstSCI CCNGG 1 cut(s) 249
BstSFI CTRYAG 1 cut(s) 447
Csp6I GTAC 2 cut(s) 158, 236
CviAII CATG 3 cut(s) 33, 37, 52
CviJI RGCY 3 cut(s) 185, 413, 491
CviKI_1 RGCY 3 cut(s) 185, 413, 491
CviQI GTAC 2 cut(s) 158, 236
DdeI CTNAG 4 cut(s) 171, 324, 399, 477
Ecl136II GAGCTC 1 cut(s) 491
Eco24I GRGCYC 1 cut(s) 493
Eco53kI GAGCTC 1 cut(s) 491
EcoICRI GAGCTC 1 cut(s) 491
EcoRII CCWGG 1 cut(s) 249
EcoT22I ATGCAT 1 cut(s) 38
EcoT38I GRGCYC 1 cut(s) 493
FaeI CATG 3 cut(s) 36, 40, 55
FaiI YATR 6 cut(s) 34, 38, 42, 53, 546, 550
FalI AAGNNNNNCTT 2 cut(s) 503, 535
FatI CATG 3 cut(s) 32, 36, 51
FblI GTMKAC 1 cut(s) 524
FriOI GRGCYC 1 cut(s) 493
FspBI CTAG 1 cut(s) 219
Hin1II CATG 3 cut(s) 36, 40, 55
HinfI GANTC 3 cut(s) 403, 454, 473
Hpy166II GTNNAC 1 cut(s) 525
Hpy188I TCNGA 2 cut(s) 142, 402
Hpy8I GTNNAC 1 cut(s) 525
HpyAV CCTTC 2 cut(s) 97, 429
HpyCH4IV ACGT 1 cut(s) 466
HpyCH4V TGCA 1 cut(s) 36
HpyF3I CTNAG 4 cut(s) 171, 324, 399, 477
HpySE526I ACGT 1 cut(s) 466
Hsp92II CATG 3 cut(s) 36, 40, 55
LmnI GCTCC 2 cut(s) 488, 496
LpnPI CCDG 6 cut(s) 79, 158, 236, 263, 311, 464
LweI GCATC 2 cut(s) 329, 404
MaeI CTAG 1 cut(s) 219
MaeII ACGT 1 cut(s) 466
MhlI GDGCHC 1 cut(s) 493
MluCI AATT 4 cut(s) 11, 62, 212, 305
MlyI GAGTC 1 cut(s) 467
MnlI CCTC 5 cut(s) 195, 249, 324, 399, 454
Mph1103I ATGCAT 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 251
MvaI CCWGG 1 cut(s) 251
NlaIII CATG 3 cut(s) 36, 40, 55
NsiI ATGCAT 1 cut(s) 38
NspI RCATGY 1 cut(s) 40
PfeI GAWTC 2 cut(s) 403, 454
PleI GAGTC 1 cut(s) 467
PpsI GAGTC 1 cut(s) 467
Psp124BI GAGCTC 1 cut(s) 493
Psp6I CCWGG 1 cut(s) 249
PspGI CCWGG 1 cut(s) 249
RsaI GTAC 2 cut(s) 159, 237
RsaNI GTAC 2 cut(s) 158, 236
SacI GAGCTC 1 cut(s) 493
SchI GAGTC 1 cut(s) 467
ScrFI CCNGG 1 cut(s) 251
SduI GDGCHC 1 cut(s) 493
SetI ASST 9 cut(s) 108, 187, 241, 316, 391, 415, 421, 469, 493
SfaNI GCATC 2 cut(s) 329, 404
SfcI CTRYAG 1 cut(s) 447
SmlI CTYRAG 2 cut(s) 315, 390
SmoI CTYRAG 2 cut(s) 315, 390
Sse9I AATT 4 cut(s) 11, 62, 212, 305
SspMI CTAG 1 cut(s) 219
SstI GAGCTC 1 cut(s) 493
StyD4I CCNGG 1 cut(s) 249
TaiI ACGT 1 cut(s) 469
TaqI TCGA 1 cut(s) 116
TasI AATT 4 cut(s) 11, 62, 212, 305
TfiI GAWTC 2 cut(s) 403, 454
XapI RAATTY 1 cut(s) 62
XceI RCATGY 1 cut(s) 40
XmiI GTMKAC 1 cut(s) 524
XspI CTAG 1 cut(s) 219
Zsp2I ATGCAT 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.