Rorug07G0246600

D-galacturonate reductase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0003272
Physical Location & Seq
Reverse (-)
22830618 .. 22833136
2519 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0246600.1

Sequence Viewer

Length: 285 bp
ATGGGTTTCCGATTGCCTGGAATCTCTAACACAAAGAGAAGTCTTACTCCATACCAAACCGTTTCAAAGACATCAGATATCCCAAAAGGCTACTTTGCGGTCTATGTTGGGGAGAGCCAGAAGAAACGATTTGTGGTTCCAATATCATATTTGAACCAACCTTTGTTTCAGGATTTGCTGAGTCAAGCTGAAGAAGAATTCGGATACCATCATCCAATGGGTGGTATCACAATTCCTTGCAGTGAGGACACCTTCCTGGATCTCACTTCCCACCTAAGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00053 map00053
Pfam Domains
Protein Families
Aldo_ket_red

Protein Analysis

94

Amino Acids

10.56

Weight (kDa)

6.25

Isoelectric Point (pI)

37.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 18 - 91 4e-25 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 221
AciI CCGC 1 cut(s) 98
AclWI GGATC 1 cut(s) 267
AcsI RAATTY 1 cut(s) 197
AcuI CTGAAG 1 cut(s) 210
AfiI CCNNNNNNNGG 1 cut(s) 221
AgsI TTSAA 2 cut(s) 66, 154
AjnI CCWGG 2 cut(s) 16, 255
AjuI GAANNNNNNNTTGG 2 cut(s) 150, 182
AleI CACNNNNGTG 1 cut(s) 276
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
AlwI GGATC 1 cut(s) 267
ApoI RAATTY 1 cut(s) 197
BccI CCATC 1 cut(s) 216
BciT130I CCWGG 2 cut(s) 18, 257
BciVI GTATCC 1 cut(s) 197
BfuI GTATCC 1 cut(s) 197
Bme1390I CCNGG 2 cut(s) 18, 257
BmiI GGNNCC 1 cut(s) 138
BmrFI CCNGG 2 cut(s) 18, 257
Bsc4I CCNNNNNNNGG 1 cut(s) 221
BseBI CCWGG 2 cut(s) 18, 257
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 221
BseMII CTCAG 1 cut(s) 170
BslI CCNNNNNNNGG 1 cut(s) 221
Bsp143I GATC 1 cut(s) 259
BspACI CCGC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 171
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 1 cut(s) 267
BssMI GATC 1 cut(s) 259
Bst2UI CCWGG 2 cut(s) 18, 257
Bst4CI ACNGT 1 cut(s) 61
BstDEI CTNAG 2 cut(s) 179, 275
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 1 cut(s) 262
BstMBI GATC 1 cut(s) 259
BstNI CCWGG 2 cut(s) 18, 257
BstSCI CCNGG 2 cut(s) 16, 255
BstX2I RGATCY 1 cut(s) 259
BstYI RGATCY 1 cut(s) 259
BsuI GTATCC 1 cut(s) 197
BtsCI GGATG 1 cut(s) 211
BtsI GCAGTG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 247
CviJI RGCY 3 cut(s) 90, 117, 188
CviKI_1 RGCY 3 cut(s) 90, 117, 188
DdeI CTNAG 2 cut(s) 179, 275
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Eco32I GATATC 1 cut(s) 79
Eco57I CTGAAG 1 cut(s) 210
EcoRI GAATTC 1 cut(s) 197
EcoRII CCWGG 2 cut(s) 16, 255
EcoRV GATATC 1 cut(s) 79
FaiI YATR 3 cut(s) 52, 105, 148
FokI GGATG 1 cut(s) 198
HinfI GANTC 2 cut(s) 21, 181
Hpy188I TCNGA 3 cut(s) 11, 76, 203
Hpy188III TCNNGA 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 262
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4V TGCA 1 cut(s) 240
HpyF3I CTNAG 2 cut(s) 179, 275
Kzo9I GATC 1 cut(s) 259
LpnPI CCDG 6 cut(s) 3, 30, 131, 155, 242, 269
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 3 cut(s) 133, 203, 206
MflI RGATCY 1 cut(s) 259
MluCI AATT 2 cut(s) 197, 231
MlyI GAGTC 1 cut(s) 190
MnlI CCTC 1 cut(s) 238
MslI CAYNNNNRTG 1 cut(s) 276
MspR9I CCNGG 2 cut(s) 18, 257
MvaI CCWGG 2 cut(s) 18, 257
NdeII GATC 1 cut(s) 259
NlaIV GGNNCC 1 cut(s) 138
OliI CACNNNNGTG 1 cut(s) 276
PfeI GAWTC 1 cut(s) 21
PflMI CCANNNNNTGG 1 cut(s) 221
PfoI TCCNGGA 1 cut(s) 255
PleI GAGTC 1 cut(s) 189
PpsI GAGTC 1 cut(s) 189
Psp6I CCWGG 2 cut(s) 16, 255
PspGI CCWGG 2 cut(s) 16, 255
PspN4I GGNNCC 1 cut(s) 138
PsuI RGATCY 1 cut(s) 259
RseI CAYNNNNRTG 1 cut(s) 276
Sau3AI GATC 1 cut(s) 259
SchI GAGTC 1 cut(s) 190
ScrFI CCNGG 2 cut(s) 18, 257
SetI ASST 4 cut(s) 163, 190, 254, 276
SgeI CNNG 8 cut(s) 29, 30, 130, 182, 197, 249, 268, 269
SmiMI CAYNNNNRTG 1 cut(s) 276
Sse9I AATT 2 cut(s) 197, 231
SsiI CCGC 1 cut(s) 98
StyD4I CCNGG 2 cut(s) 16, 255
TaaI ACNGT 1 cut(s) 61
TasI AATT 2 cut(s) 197, 231
TfiI GAWTC 1 cut(s) 21
TscAI CASTG 1 cut(s) 247
TspRI CASTG 1 cut(s) 247
Van91I CCANNNNNTGG 1 cut(s) 221
XapI RAATTY 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.