Rh1BG311500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
44597997 .. 44598188
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG311500.1

Sequence Viewer

Length: 192 bp
ATGGACAGCGATGATCTTGAGAGCCTTGATGAGAGGTCAAGTGATGAAGAGGTTGATGAGCCTGTAAAACAACCAAAGTTCAAGCAGTATAGAAGAGATACTGACTTAAGGGATCCACACTTCAAACTGGGTCTAGAGTTTCCAACTATGACACAATGTAGGGAGGCCATATATAAGAGAATTGTCCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.6

Weight (kDa)

4.88

Isoelectric Point (pI)

47.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 107, 120
AflII CTTAAG 1 cut(s) 106
AgsI TTSAA 2 cut(s) 82, 124
AlwI GGATC 2 cut(s) 107, 120
AoxI GGCC 1 cut(s) 165
BamHI GGATCC 1 cut(s) 112
BfaI CTAG 1 cut(s) 134
BfrI CTTAAG 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 114
BmrI ACTGGG 1 cut(s) 137
BmuI ACTGGG 1 cut(s) 137
BpuEI CTTGAG 1 cut(s) 38
Bse1I ACTGG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 132
BshFI GGCC 1 cut(s) 167
BsnI GGCC 1 cut(s) 167
Bsp143I GATC 2 cut(s) 13, 112
BspANI GGCC 1 cut(s) 167
BspLI GGNNCC 1 cut(s) 114
BspPI GGATC 2 cut(s) 107, 120
BspTI CTTAAG 1 cut(s) 106
BsrI ACTGG 1 cut(s) 132
BssMI GATC 2 cut(s) 13, 112
Bst6I CTCTTC 2 cut(s) 42, 88
BstAFI CTTAAG 1 cut(s) 106
BstKTI GATC 2 cut(s) 16, 115
BstMBI GATC 2 cut(s) 13, 112
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
BsuRI GGCC 1 cut(s) 167
BtgZI GCGATG 1 cut(s) 24
CviJI RGCY 3 cut(s) 24, 61, 167
CviKI_1 RGCY 3 cut(s) 24, 61, 167
DpnI GATC 2 cut(s) 15, 114
DpnII GATC 2 cut(s) 13, 112
Eam1104I CTCTTC 2 cut(s) 42, 88
EarI CTCTTC 2 cut(s) 42, 88
FaiI YATR 5 cut(s) 90, 149, 170, 172, 174
FspBI CTAG 1 cut(s) 134
HaeIII GGCC 1 cut(s) 167
Hpy188III TCNNGA 2 cut(s) 17, 134
Kzo9I GATC 2 cut(s) 13, 112
LpnPI CCDG 2 cut(s) 75, 113
MaeI CTAG 1 cut(s) 134
MalI GATC 2 cut(s) 15, 114
MboI GATC 2 cut(s) 13, 112
MboII GAAGA 2 cut(s) 59, 105
MflI RGATCY 1 cut(s) 112
MluCI AATT 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 167
MnlI CCTC 3 cut(s) 27, 43, 157
MseI TTAA 2 cut(s) 107, 190
MspCI CTTAAG 1 cut(s) 106
NdeII GATC 2 cut(s) 13, 112
NlaIV GGNNCC 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 114
PsuI RGATCY 1 cut(s) 112
SaqAI TTAA 2 cut(s) 107, 190
Sau3AI GATC 2 cut(s) 13, 112
SetI ASST 2 cut(s) 38, 54
SgeI CNNG 7 cut(s) 29, 38, 51, 74, 94, 140, 146
SmlI CTYRAG 2 cut(s) 17, 106
SmoI CTYRAG 2 cut(s) 17, 106
Sse9I AATT 1 cut(s) 180
SspMI CTAG 1 cut(s) 134
TasI AATT 1 cut(s) 180
Tru1I TTAA 2 cut(s) 107, 190
Tru9I TTAA 2 cut(s) 107, 190
TspDTI ATGAA 1 cut(s) 60
TspGWI ACGGA 1 cut(s) 176
Vha464I CTTAAG 1 cut(s) 106
XbaI TCTAGA 1 cut(s) 133
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.