Rh1DG137800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
29000449 .. 29000721
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG137800.1

Sequence Viewer

Length: 273 bp
ATGGTGTTCAATATGTTAGAGTTGGGGGGACTAGAGGAGGAAGAGGCCAATTTGTTGCTCCTACAAGAGAAAGAGGATAGTTTGAAAGCTTTATTGGAAGGTCACAATCTACAAGTTTCGGTACTAAAGGAGGAGGACAAACAATTGCAAGTGCCGGAAGAGGAAGAAGCCAATTCATTGCTCCAAAAAGAGGAAAATGGCAACCTACAAGCTTGGGTAATGGTGGAGGACAAGCTCTTCCAGGTATTGGAAGAGGAAGGGGACAATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.33

Weight (kDa)

4.05

Isoelectric Point (pI)

74.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 247
AfaI GTAC 1 cut(s) 123
AfiI CCNNNNNNNGG 2 cut(s) 190, 247
AgsI TTSAA 2 cut(s) 10, 85
AjnI CCWGG 1 cut(s) 240
AjuI GAANNNNNNNTTGG 2 cut(s) 77, 109
AluBI AGCT 3 cut(s) 89, 212, 235
AluI AGCT 3 cut(s) 89, 212, 235
AoxI GGCC 1 cut(s) 45
BciT130I CCWGG 1 cut(s) 242
BfaI CTAG 1 cut(s) 32
Bme1390I CCNGG 1 cut(s) 242
BmrFI CCNGG 1 cut(s) 242
Bsc4I CCNNNNNNNGG 2 cut(s) 190, 247
Bse3DI GCAATG 1 cut(s) 176
BseBI CCWGG 1 cut(s) 242
BseLI CCNNNNNNNGG 2 cut(s) 190, 247
BseMI GCAATG 1 cut(s) 176
BseRI GAGGAG 2 cut(s) 50, 146
BshFI GGCC 1 cut(s) 47
BsiSI CCGG 1 cut(s) 155
BslFI GGGAC 1 cut(s) 42
BslI CCNNNNNNNGG 2 cut(s) 190, 247
BsmFI GGGAC 1 cut(s) 42
BsnI GGCC 1 cut(s) 47
BspANI GGCC 1 cut(s) 47
BspQI GCTCTTC 1 cut(s) 242
BsrDI GCAATG 1 cut(s) 176
Bst2UI CCWGG 1 cut(s) 242
Bst6I CTCTTC 4 cut(s) 36, 153, 242, 246
BstNI CCWGG 1 cut(s) 242
BstSCI CCNGG 1 cut(s) 240
BsuRI GGCC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 122
CviJI RGCY 5 cut(s) 47, 89, 170, 212, 235
CviKI_1 RGCY 5 cut(s) 47, 89, 170, 212, 235
CviQI GTAC 1 cut(s) 122
Eam1104I CTCTTC 4 cut(s) 36, 153, 242, 246
EarI CTCTTC 4 cut(s) 36, 153, 242, 246
EcoRII CCWGG 1 cut(s) 240
FaiI YATR 2 cut(s) 14, 269
FaqI GGGAC 1 cut(s) 42
FspBI CTAG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 47
HapII CCGG 1 cut(s) 155
HindIII AAGCTT 2 cut(s) 87, 210
HpaII CCGG 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 92, 251
HpyCH4V TGCA 1 cut(s) 148
LguI GCTCTTC 1 cut(s) 242
LmnI GCTCC 2 cut(s) 63, 186
LpnPI CCDG 3 cut(s) 168, 227, 254
MaeI CTAG 1 cut(s) 32
MaeIII GTNAC 1 cut(s) 101
MboII GAAGA 5 cut(s) 53, 170, 176, 229, 263
MfeI CAATTG 1 cut(s) 143
MluCI AATT 3 cut(s) 49, 143, 172
MspI CCGG 1 cut(s) 155
MspR9I CCNGG 1 cut(s) 242
MunI CAATTG 1 cut(s) 143
MvaI CCWGG 1 cut(s) 242
NmuCI GTSAC 1 cut(s) 101
PciSI GCTCTTC 1 cut(s) 242
PflMI CCANNNNNTGG 1 cut(s) 247
Psp6I CCWGG 1 cut(s) 240
PspGI CCWGG 1 cut(s) 240
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SapI GCTCTTC 1 cut(s) 242
ScrFI CCNGG 1 cut(s) 242
SetI ASST 6 cut(s) 91, 103, 207, 214, 237, 246
Sse9I AATT 3 cut(s) 49, 143, 172
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 1 cut(s) 240
TasI AATT 3 cut(s) 49, 143, 172
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 165
Van91I CCANNNNNTGG 1 cut(s) 247
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.