Rh6AG151900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
23799770 .. 23800282
513 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG151900.1

Sequence Viewer

Length: 282 bp
ATGTCACAATCTACAAGTTTCAGTACTAGAGGAGGACAAACTATTGCAAGTGTCAGAAGAGGAAGAAGCCAATTCATTGCTCCAACAAGAGGAAAAAGGCAACCTACAAGCTCTAGTACTGAAAGAGGAAGGGGACAATATGTCAATCGTGCCACTCGTATAAATCAAGTGGCAATGCATTCTACAATCAGTACTGAGGTTACCGCATCTCAACCAATTTCTAAAGCTAGAAGTAGTGAATCAACTACAAGGCATGTTACTCACTTACTCTGCCAACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.21

Weight (kDa)

12.0

Isoelectric Point (pI)

67.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 204
AfaI GTAC 3 cut(s) 25, 118, 193
AfiI CCNNNNNNNGG 1 cut(s) 89
AhdI GACNNNNNGTC 1 cut(s) 140
AluBI AGCT 2 cut(s) 111, 227
AluI AGCT 2 cut(s) 111, 227
BfaI CTAG 3 cut(s) 27, 114, 228
BmcAI AGTACT 3 cut(s) 25, 118, 193
BmeRI GACNNNNNGTC 1 cut(s) 140
BmsI GCATC 1 cut(s) 215
Bsc4I CCNNNNNNNGG 1 cut(s) 89
Bse3DI GCAATG 2 cut(s) 75, 180
BseLI CCNNNNNNNGG 1 cut(s) 89
BseMI GCAATG 2 cut(s) 75, 180
BseMII CTCAG 1 cut(s) 186
BseRI GAGGAG 1 cut(s) 45
BslFI GGGAC 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 89
BsmFI GGGAC 1 cut(s) 147
BsmI GAATGC 1 cut(s) 178
BspACI CCGC 1 cut(s) 204
BspCNI CTCAG 1 cut(s) 187
BsrDI GCAATG 2 cut(s) 75, 180
Bst4CI ACNGT 1 cut(s) 279
Bst6I CTCTTC 1 cut(s) 52
BstDEI CTNAG 1 cut(s) 195
BstEII GGTNACC 1 cut(s) 199
BstNSI RCATGY 1 cut(s) 257
BstPI GGTNACC 1 cut(s) 199
Csp6I GTAC 3 cut(s) 24, 117, 192
CviAII CATG 1 cut(s) 254
CviJI RGCY 3 cut(s) 69, 111, 227
CviKI_1 RGCY 3 cut(s) 69, 111, 227
CviQI GTAC 3 cut(s) 24, 117, 192
DdeI CTNAG 1 cut(s) 195
DriI GACNNNNNGTC 1 cut(s) 140
Eam1104I CTCTTC 1 cut(s) 52
Eam1105I GACNNNNNGTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 52
Eco91I GGTNACC 1 cut(s) 199
EcoO65I GGTNACC 1 cut(s) 199
EcoT22I ATGCAT 1 cut(s) 180
FaeI CATG 1 cut(s) 257
FaiI YATR 3 cut(s) 141, 161, 255
FaqI GGGAC 1 cut(s) 147
FatI CATG 1 cut(s) 253
FspBI CTAG 3 cut(s) 27, 114, 228
Hin1II CATG 1 cut(s) 257
HinfI GANTC 1 cut(s) 239
Hpy188I TCNGA 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 123
HpyCH4III ACNGT 1 cut(s) 279
HpyCH4V TGCA 2 cut(s) 47, 178
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 1 cut(s) 257
LmnI GCTCC 1 cut(s) 85
LweI GCATC 1 cut(s) 215
MaeI CTAG 3 cut(s) 27, 114, 228
MaeIII GTNAC 3 cut(s) 3, 199, 256
MboII GAAGA 2 cut(s) 69, 75
MluCI AATT 2 cut(s) 71, 216
MmeI TCCRAC 1 cut(s) 107
MnlI CCTC 6 cut(s) 23, 26, 53, 83, 119, 190
Mph1103I ATGCAT 1 cut(s) 180
Mva1269I GAATGC 1 cut(s) 178
NlaIII CATG 1 cut(s) 257
NmuCI GTSAC 1 cut(s) 3
NsiI ATGCAT 1 cut(s) 180
NspI RCATGY 1 cut(s) 257
PcsI WCGNNNNNNNCGW 1 cut(s) 154
PctI GAATGC 1 cut(s) 178
PfeI GAWTC 1 cut(s) 239
PspEI GGTNACC 1 cut(s) 199
RsaI GTAC 3 cut(s) 25, 118, 193
RsaNI GTAC 3 cut(s) 24, 117, 192
ScaI AGTACT 3 cut(s) 25, 118, 193
SetI ASST 4 cut(s) 106, 113, 201, 229
SfaNI GCATC 1 cut(s) 215
Sse9I AATT 2 cut(s) 71, 216
SsiI CCGC 1 cut(s) 204
SspMI CTAG 3 cut(s) 27, 114, 228
TaaI ACNGT 1 cut(s) 279
TasI AATT 2 cut(s) 71, 216
TatI WGTACW 3 cut(s) 23, 116, 191
TfiI GAWTC 1 cut(s) 239
TseFI GTSAC 1 cut(s) 3
Tsp45I GTSAC 1 cut(s) 3
TspDTI ATGAA 1 cut(s) 64
XceI RCATGY 1 cut(s) 257
XspI CTAG 3 cut(s) 27, 114, 228
ZrmI AGTACT 3 cut(s) 25, 118, 193
Zsp2I ATGCAT 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.