Rh1CG087200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
18358955 .. 18364099
5145 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG087200.1

Sequence Viewer

Length: 291 bp
ATGAAAACCAGCAACACATCCAAATTGATCAGCCTACAGCGTCATCCAAGACTTCAACTTCCTGATGGGGATTCTCCCCAAGGGCGTCACTGGCTACGAGCTCGATTGGAGCAACGACAAGGTCTTGTTCCTACGCCACCTCAACGGTCAGTAAATCACATATTCCAAATCCTCCCAGCAAATCACATATTCCAAATCCTCCCAGCAAATCACATATTCACTGCTTTCATGATTTCAGAAAATGCTTACGGTGGTTTCATGGTTTTAGTGGAGGTCTTTAGTTATCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

11.06

Weight (kDa)

10.83

Isoelectric Point (pI)

71.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 85
AgsI TTSAA 1 cut(s) 56
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw21I GWGCWC 1 cut(s) 103
BanII GRGCYC 1 cut(s) 103
Bbv12I GWGCWC 1 cut(s) 103
BccI CCATC 1 cut(s) 59
BclI TGATCA 1 cut(s) 27
BfmI CTRYAG 1 cut(s) 35
BsaHI GRCGYC 1 cut(s) 85
BsaJI CCNNGG 1 cut(s) 79
Bse1I ACTGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 2 cut(s) 17, 43
BseNI ACTGG 1 cut(s) 95
BseYI CCCAGC 2 cut(s) 175, 202
BsiHKAI GWGCWC 1 cut(s) 103
Bsp1286I GDGCHC 1 cut(s) 103
Bsp143I GATC 1 cut(s) 27
BspHI TCATGA 1 cut(s) 228
BsrI ACTGG 1 cut(s) 95
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 27
BssNI GRCGYC 1 cut(s) 85
BssT1I CCWWGG 1 cut(s) 79
Bst4CI ACNGT 2 cut(s) 147, 251
BstACI GRCGYC 1 cut(s) 85
BstF5I GGATG 2 cut(s) 17, 43
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstMWI GCNNNNNNNGC 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 35
BtsCI GGATG 2 cut(s) 17, 43
BtsI GCAGTG 1 cut(s) 219
BtsIMutI CAGTG 2 cut(s) 88, 219
CciI TCATGA 1 cut(s) 228
CseI GACGC 2 cut(s) 29, 74
CviAII CATG 2 cut(s) 229, 259
CviJI RGCY 3 cut(s) 33, 94, 101
CviKI_1 RGCY 3 cut(s) 33, 94, 101
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
Ecl136II GAGCTC 1 cut(s) 101
Eco130I CCWWGG 1 cut(s) 79
Eco24I GRGCYC 1 cut(s) 103
Eco53kI GAGCTC 1 cut(s) 101
EcoICRI GAGCTC 1 cut(s) 101
EcoT14I CCWWGG 1 cut(s) 79
EcoT38I GRGCYC 1 cut(s) 103
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 2 cut(s) 232, 262
FaiI YATR 5 cut(s) 161, 188, 215, 230, 260
FatI CATG 2 cut(s) 228, 258
FbaI TGATCA 1 cut(s) 27
FokI GGATG 2 cut(s) 4, 30
FriOI GRGCYC 1 cut(s) 103
GsaI CCCAGC 2 cut(s) 179, 206
HgaI GACGC 2 cut(s) 29, 74
Hin1I GRCGYC 1 cut(s) 85
Hin1II CATG 2 cut(s) 232, 262
HinfI GANTC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 238
Hpy188III TCNNGA 2 cut(s) 62, 229
HpyCH4III ACNGT 2 cut(s) 147, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
Hsp92I GRCGYC 1 cut(s) 85
Hsp92II CATG 2 cut(s) 232, 262
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 1 cut(s) 27
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 5 cut(s) 22, 75, 76, 189, 216
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MhlI GDGCHC 1 cut(s) 103
MluCI AATT 1 cut(s) 23
MnlI CCTC 4 cut(s) 150, 182, 209, 265
MwoI GCNNNNNNNGC 1 cut(s) 91
NdeII GATC 1 cut(s) 27
NlaIII CATG 2 cut(s) 232, 262
NmuCI GTSAC 1 cut(s) 86
PagI TCATGA 1 cut(s) 228
PfeI GAWTC 1 cut(s) 71
PflFI GACNNNGTC 1 cut(s) 120
Psp124BI GAGCTC 1 cut(s) 103
PspFI CCCAGC 2 cut(s) 175, 202
PsyI GACNNNGTC 1 cut(s) 120
SacI GAGCTC 1 cut(s) 103
Sau3AI GATC 1 cut(s) 27
SduI GDGCHC 1 cut(s) 103
SetI ASST 4 cut(s) 103, 124, 142, 276
SfcI CTRYAG 1 cut(s) 35
Sse9I AATT 1 cut(s) 23
SstI GAGCTC 1 cut(s) 103
StyI CCWWGG 1 cut(s) 79
TaaI ACNGT 2 cut(s) 147, 251
TaqI TCGA 1 cut(s) 103
TasI AATT 1 cut(s) 23
TfiI GAWTC 1 cut(s) 71
TscAI CASTG 2 cut(s) 95, 226
TseFI GTSAC 1 cut(s) 86
Tsp45I GTSAC 1 cut(s) 86
TspDTI ATGAA 3 cut(s) 17, 217, 247
TspRI CASTG 2 cut(s) 95, 226
Tth111I GACNNNGTC 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.