Rh2CG175600

Ribonuclease P protein subunit p25-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
16049673 .. 16065387
15715 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG175600.1

Sequence Viewer

Length: 195 bp
ATGGATCGGTACCAGAGAGTGGAGAAGCCAAGAGCAGAGACGCCAATTGATGAGAATGAGATTAGGATTACGAGCCAAGGGAGGATGCGAAACTACATCACTTACGCCATGACTCTGCTTCAGACGTTTCTAAGCTGTCCATCTTGGTTTAAGACTAAATATTACCAAGCTATATGGTGGGGCAAGGTTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.81

Weight (kDa)

9.51

Isoelectric Point (pI)

31.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 9
AccB1I GGYRCC 1 cut(s) 9
AccB7I CCANNNNNTGG 1 cut(s) 19
AclWI GGATC 1 cut(s) 12
AcuI CTGAAG 1 cut(s) 104
AcyI GRCGYC 1 cut(s) 41
AfaI GTAC 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 19
AluBI AGCT 2 cut(s) 135, 170
AluI AGCT 2 cut(s) 135, 170
Alw26I GTCTC 1 cut(s) 32
AlwI GGATC 1 cut(s) 12
Asp718I GGTACC 1 cut(s) 9
BanI GGYRCC 1 cut(s) 9
BccI CCATC 1 cut(s) 148
BcoDI GTCTC 1 cut(s) 32
BmiI GGNNCC 2 cut(s) 11, 189
BmsI GCATC 1 cut(s) 75
BsaHI GRCGYC 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 76
Bsc4I CCNNNNNNNGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 76
BseGI GGATG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 19
BshNI GGYRCC 1 cut(s) 9
BslI CCNNNNNNNGG 1 cut(s) 19
BsmAI GTCTC 1 cut(s) 32
BsmBI CGTCTC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 4
BspLI GGNNCC 2 cut(s) 11, 189
BspPI GGATC 1 cut(s) 12
BspT107I GGYRCC 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 76
BssMI GATC 1 cut(s) 4
BssNI GRCGYC 1 cut(s) 41
BssT1I CCWWGG 1 cut(s) 76
BstACI GRCGYC 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 131
BstF5I GGATG 1 cut(s) 90
BstKTI GATC 1 cut(s) 7
BstMAI GTCTC 1 cut(s) 32
BstMBI GATC 1 cut(s) 4
BtsCI GGATG 1 cut(s) 90
CseI GACGC 1 cut(s) 49
Csp6I GTAC 1 cut(s) 10
CviAII CATG 1 cut(s) 109
CviJI RGCY 4 cut(s) 28, 75, 135, 170
CviKI_1 RGCY 4 cut(s) 28, 75, 135, 170
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 1 cut(s) 131
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eco130I CCWWGG 1 cut(s) 76
Eco57I CTGAAG 1 cut(s) 104
EcoT14I CCWWGG 1 cut(s) 76
ErhI CCWWGG 1 cut(s) 76
Esp3I CGTCTC 1 cut(s) 32
FaeI CATG 1 cut(s) 112
FaiI YATR 3 cut(s) 110, 173, 175
FatI CATG 1 cut(s) 108
FokI GGATG 1 cut(s) 97
HgaI GACGC 1 cut(s) 49
Hin1I GRCGYC 1 cut(s) 41
Hin1II CATG 1 cut(s) 112
HinfI GANTC 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 123
HpyCH4IV ACGT 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 131
HpySE526I ACGT 1 cut(s) 125
Hsp92I GRCGYC 1 cut(s) 41
Hsp92II CATG 1 cut(s) 112
KpnI GGTACC 1 cut(s) 13
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 26
LweI GCATC 1 cut(s) 75
MaeII ACGT 1 cut(s) 125
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MfeI CAATTG 1 cut(s) 45
MluCI AATT 1 cut(s) 45
MlyI GAGTC 1 cut(s) 106
MnlI CCTC 1 cut(s) 75
MseI TTAA 2 cut(s) 150, 193
MunI CAATTG 1 cut(s) 45
NdeII GATC 1 cut(s) 4
NlaIII CATG 1 cut(s) 112
NlaIV GGNNCC 2 cut(s) 11, 189
PflMI CCANNNNNTGG 1 cut(s) 19
PleI GAGTC 1 cut(s) 106
PpsI GAGTC 1 cut(s) 106
PspN4I GGNNCC 2 cut(s) 11, 189
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SaqAI TTAA 2 cut(s) 150, 193
Sau3AI GATC 1 cut(s) 4
SchI GAGTC 1 cut(s) 106
SetI ASST 4 cut(s) 128, 137, 172, 189
SfaNI GCATC 1 cut(s) 75
SgeI CNNG 7 cut(s) 25, 42, 84, 89, 121, 156, 179
Sse9I AATT 1 cut(s) 45
SspI AATATT 1 cut(s) 161
StyI CCWWGG 1 cut(s) 76
TaiI ACGT 1 cut(s) 128
TasI AATT 1 cut(s) 45
Tru1I TTAA 2 cut(s) 150, 193
Tru9I TTAA 2 cut(s) 150, 193
Van91I CCANNNNNTGG 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.