Rh3AG092100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
7529015 .. 7530650
1636 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG092100.1

Sequence Viewer

Length: 228 bp
ATGGCGAGCAAAAGCTCCAAATCCAACACCAAGATTAGCACGATCAAGATTAACAGCCCCCACTGTAGCGATATAGTCTTTGATACCCCCATTCCTTCATGTCCTTGGAAAGACGGCGAGGGGTTCACCATTGGCCTTGGACCAGGAGACCCCGAGGACTTGCCGGAAGTTTTCGACAAGATAACTTTGATGACTATTCAGACGAGTCAGACGATGATGATGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.16

Weight (kDa)

4.75

Isoelectric Point (pI)

32.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 1 cut(s) 15
AluI AGCT 1 cut(s) 15
Alw26I GTCTC 1 cut(s) 141
Ama87I CYCGRG 1 cut(s) 152
AoxI GGCC 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 118
AvaI CYCGRG 1 cut(s) 152
AvaII GGWCC 1 cut(s) 140
BceAI ACGGC 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 144
BcoDI GTCTC 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 64
Bme1390I CCNGG 1 cut(s) 144
Bme18I GGWCC 1 cut(s) 140
BmeT110I CYCGRG 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 140
BmrFI CCNGG 1 cut(s) 144
BsaI GGTCTC 1 cut(s) 141
BsaJI CCNNGG 3 cut(s) 104, 136, 153
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 3 cut(s) 104, 136, 153
BshFI GGCC 1 cut(s) 135
BsiHKCI CYCGRG 1 cut(s) 152
BsiSI CCGG 1 cut(s) 164
BsmAI GTCTC 1 cut(s) 141
BsnI GGCC 1 cut(s) 135
Bso31I GGTCTC 1 cut(s) 141
BsoBI CYCGRG 1 cut(s) 152
Bsp143I GATC 1 cut(s) 42
BspANI GGCC 1 cut(s) 135
BspTNI GGTCTC 1 cut(s) 141
BssECI CCNNGG 3 cut(s) 104, 136, 153
BssMI GATC 1 cut(s) 42
BssT1I CCWWGG 2 cut(s) 104, 136
Bst2UI CCWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 1 cut(s) 45
BstMAI GTCTC 1 cut(s) 141
BstMBI GATC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BstSFI CTRYAG 1 cut(s) 64
BsuRI GGCC 1 cut(s) 135
BtsIMutI CAGTG 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 140
CviAII CATG 1 cut(s) 99
CviJI RGCY 3 cut(s) 15, 57, 135
CviKI_1 RGCY 3 cut(s) 15, 57, 135
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
Eco130I CCWWGG 2 cut(s) 104, 136
Eco31I GGTCTC 1 cut(s) 141
Eco47I GGWCC 1 cut(s) 140
Eco88I CYCGRG 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 142
EcoT14I CCWWGG 2 cut(s) 104, 136
ErhI CCWWGG 2 cut(s) 104, 136
FaeI CATG 1 cut(s) 102
FaiI YATR 2 cut(s) 74, 100
FatI CATG 1 cut(s) 98
HaeIII GGCC 1 cut(s) 135
HapII CCGG 1 cut(s) 164
Hin1II CATG 1 cut(s) 102
HinfI GANTC 1 cut(s) 205
HpaII CCGG 1 cut(s) 164
HphI GGTGA 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 2 cut(s) 201, 210
Hpy188III TCNNGA 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 126
HpyAV CCTTC 1 cut(s) 105
HpyCH4III ACNGT 1 cut(s) 65
Hsp92II CATG 1 cut(s) 102
Kzo9I GATC 1 cut(s) 42
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 3 cut(s) 129, 156, 177
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MlyI GAGTC 1 cut(s) 214
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 2 cut(s) 112, 148
MseI TTAA 1 cut(s) 51
MspI CCGG 1 cut(s) 164
MspR9I CCNGG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 144
NdeII GATC 1 cut(s) 42
NlaIII CATG 1 cut(s) 102
PcsI WCGNNNNNNNCGW 1 cut(s) 209
PleI GAGTC 1 cut(s) 213
PpsI GAGTC 1 cut(s) 213
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspPI GGNCC 1 cut(s) 140
SaqAI TTAA 1 cut(s) 51
Sau3AI GATC 1 cut(s) 42
Sau96I GGNCC 1 cut(s) 140
SchI GAGTC 1 cut(s) 214
ScrFI CCNGG 1 cut(s) 144
SetI ASST 1 cut(s) 17
SfcI CTRYAG 1 cut(s) 64
SinI GGWCC 1 cut(s) 140
StyD4I CCNGG 1 cut(s) 142
StyI CCWWGG 2 cut(s) 104, 136
TaaI ACNGT 1 cut(s) 65
TaqI TCGA 1 cut(s) 174
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TscAI CASTG 1 cut(s) 68
TspDTI ATGAA 1 cut(s) 87
TspRI CASTG 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.