Rh3DG272600

CAX-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0003424
Physical Location & Seq
Reverse (-)
27355961 .. 27356568
608 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG272600.1

Sequence Viewer

Length: 279 bp
ATGTCGTTTCGCAAGACAGCTTGCCAATTGGTTTTCAATTTCGGCCGAATTATGTCGTGGAAAGATCGAAATCTTAGTACAGCGAATTTGAAGATGGCGGACACTGTAGGAAGGGTCCGCATACCCCTAGACAATCGGGTACACAGTAGTGTTGCCCTTCAAATTCATGGTATATGGCAGAGTACAATTGGGTACGATCCCTATGCACCTCAGCTACATTTGTCAAACTCAAAACCAGATGCTGAGAATGCATATGCTAGCTACCAAGCCCTTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-CCHC_3

Protein Analysis

92

Amino Acids

10.4

Weight (kDa)

9.58

Isoelectric Point (pI)

41.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 98, 118
AclWI GGATC 1 cut(s) 191
AcoI YGGCCR 1 cut(s) 43
AcsI RAATTY 2 cut(s) 85, 162
AfaI GTAC 4 cut(s) 79, 141, 184, 194
AgsI TTSAA 3 cut(s) 37, 91, 161
AleI CACNNNNGTG 1 cut(s) 147
AluBI AGCT 3 cut(s) 20, 214, 261
AluI AGCT 3 cut(s) 20, 214, 261
AlwI GGATC 1 cut(s) 191
AlwNI CAGNNNCTG 1 cut(s) 242
AoxI GGCC 1 cut(s) 43
ApoI RAATTY 2 cut(s) 85, 162
AspS9I GGNCC 1 cut(s) 115
AsuNHI GCTAGC 1 cut(s) 257
AvaII GGWCC 1 cut(s) 115
BbvCI CCTCAGC 1 cut(s) 210
BccI CCATC 1 cut(s) 88
BcgI CGANNNNNNTGC 2 cut(s) 185, 219
BfaI CTAG 2 cut(s) 128, 258
BfmI CTRYAG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
BmiI GGNNCC 1 cut(s) 116
BmsI GCATC 1 cut(s) 229
BmtI GCTAGC 1 cut(s) 261
Bpu10I CCTNAGC 1 cut(s) 210
BsaBI GATNNNNATC 1 cut(s) 69
Bse8I GATNNNNATC 1 cut(s) 69
BseJI GATNNNNATC 1 cut(s) 69
BseMII CTCAG 2 cut(s) 224, 234
BseX3I CGGCCG 1 cut(s) 43
Bsh1285I CGRYCG 1 cut(s) 46
BshFI GGCC 1 cut(s) 45
BsiEI CGRYCG 1 cut(s) 46
BsmI GAATGC 1 cut(s) 253
BsnI GGCC 1 cut(s) 45
Bsp143I GATC 2 cut(s) 64, 196
BspACI CCGC 2 cut(s) 98, 118
BspANI GGCC 1 cut(s) 45
BspCNI CTCAG 2 cut(s) 223, 235
BspLI GGNNCC 1 cut(s) 116
BspOI GCTAGC 1 cut(s) 261
BspPI GGATC 1 cut(s) 191
BssMI GATC 2 cut(s) 64, 196
Bst4CI ACNGT 2 cut(s) 106, 146
BstC8I GCNNGC 2 cut(s) 22, 259
BstDEI CTNAG 3 cut(s) 74, 210, 243
BstKTI GATC 2 cut(s) 67, 199
BstMBI GATC 2 cut(s) 64, 196
BstMCI CGRYCG 1 cut(s) 46
BstMWI GCNNNNNNNGC 1 cut(s) 248
BstSFI CTRYAG 1 cut(s) 105
BstZI CGGCCG 1 cut(s) 43
BsuRI GGCC 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 102
Cac8I GCNNGC 2 cut(s) 22, 259
CaiI CAGNNNCTG 1 cut(s) 242
Cfr13I GGNCC 1 cut(s) 115
Csp6I GTAC 4 cut(s) 78, 140, 183, 193
CviAII CATG 1 cut(s) 167
CviJI RGCY 5 cut(s) 20, 45, 214, 261, 269
CviKI_1 RGCY 5 cut(s) 20, 45, 214, 261, 269
CviQI GTAC 4 cut(s) 78, 140, 183, 193
DdeI CTNAG 3 cut(s) 74, 210, 243
DpnI GATC 2 cut(s) 66, 198
DpnII GATC 2 cut(s) 64, 196
EaeI YGGCCR 1 cut(s) 43
EagI CGGCCG 1 cut(s) 43
EciI GGCGGA 1 cut(s) 113
EclXI CGGCCG 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 115
Eco52I CGGCCG 1 cut(s) 43
EcoT22I ATGCAT 1 cut(s) 253
FaeI CATG 1 cut(s) 170
FaiI YATR 8 cut(s) 53, 122, 168, 173, 175, 204, 253, 255
FatI CATG 1 cut(s) 166
FauNDI CATATG 1 cut(s) 253
FspBI CTAG 2 cut(s) 128, 258
HaeIII GGCC 1 cut(s) 45
Hin1II CATG 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 2 cut(s) 105, 167
HpyCH4III ACNGT 2 cut(s) 106, 146
HpyCH4V TGCA 2 cut(s) 206, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 248
HpyF3I CTNAG 3 cut(s) 74, 210, 243
Hsp92II CATG 1 cut(s) 170
Kzo9I GATC 2 cut(s) 64, 196
LpnPI CCDG 1 cut(s) 249
LweI GCATC 1 cut(s) 229
MaeI CTAG 2 cut(s) 128, 258
MalI GATC 2 cut(s) 66, 198
MboI GATC 2 cut(s) 64, 196
MboII GAAGA 1 cut(s) 103
MfeI CAATTG 2 cut(s) 26, 186
MluCI AATT 6 cut(s) 26, 37, 48, 85, 162, 186
MnlI CCTC 1 cut(s) 219
Mph1103I ATGCAT 1 cut(s) 253
MslI CAYNNNNRTG 1 cut(s) 147
MunI CAATTG 2 cut(s) 26, 186
Mva1269I GAATGC 1 cut(s) 253
MwoI GCNNNNNNNGC 1 cut(s) 248
NdeI CATATG 1 cut(s) 253
NdeII GATC 2 cut(s) 64, 196
NheI GCTAGC 1 cut(s) 257
NlaIII CATG 1 cut(s) 170
NlaIV GGNNCC 1 cut(s) 116
NsiI ATGCAT 1 cut(s) 253
OliI CACNNNNGTG 1 cut(s) 147
PctI GAATGC 1 cut(s) 253
PspN4I GGNNCC 1 cut(s) 116
PspPI GGNCC 1 cut(s) 115
PstNI CAGNNNCTG 1 cut(s) 242
RsaI GTAC 4 cut(s) 79, 141, 184, 194
RsaNI GTAC 4 cut(s) 78, 140, 183, 193
RseI CAYNNNNRTG 1 cut(s) 147
Sau3AI GATC 2 cut(s) 64, 196
Sau96I GGNCC 1 cut(s) 115
SetI ASST 4 cut(s) 22, 211, 216, 263
SfaNI GCATC 1 cut(s) 229
SfcI CTRYAG 1 cut(s) 105
SgeI CNNG 8 cut(s) 25, 33, 69, 140, 149, 179, 248, 270
SinI GGWCC 1 cut(s) 115
SmiMI CAYNNNNRTG 1 cut(s) 147
Sse9I AATT 6 cut(s) 26, 37, 48, 85, 162, 186
SsiI CCGC 2 cut(s) 98, 118
SspMI CTAG 2 cut(s) 128, 258
TaaI ACNGT 2 cut(s) 106, 146
TaqI TCGA 1 cut(s) 67
TasI AATT 6 cut(s) 26, 37, 48, 85, 162, 186
TatI WGTACW 2 cut(s) 77, 182
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 155
TspRI CASTG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 2 cut(s) 85, 162
XspI CTAG 2 cut(s) 128, 258
Zsp2I ATGCAT 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.