Rh4DG220700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
42202430 .. 42202798
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG220700.1

Sequence Viewer

Length: 369 bp
ATGAAGGAAGACCCAGAGAATTCAGGCCATGTTGTTGAGGATGGTGCTACAGAAGTTCTTGAACATGAGAAATCAGAACACCTTGGAAAGATTCATGATGAAGATGGTTTGGATCATGAAACATCTGACTCTAATTTGAAGAAATCAGAACACCTTGGAAAGATTCGTGATGAAGATGGTTTGGATCCTGAAACATCTGACTCTAATTTGAAGAAATCTGGGCATCATCGAAAGATTCATGATGAAGCTGGCTTAGATTATGAAACATCCGACTCTGATTTGAAGAGACAAAAGCTTATGATTGGGCTTCCTAGCAACCCAACAGAGTCGTTCACTCTTTCGGATAGCTCACGCACAGAGGTATGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.6

Weight (kDa)

4.78

Isoelectric Point (pI)

37.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 120, 179, 192
AcsI RAATTY 1 cut(s) 19
AgsI TTSAA 4 cut(s) 62, 139, 211, 283
AluBI AGCT 3 cut(s) 248, 295, 348
AluI AGCT 3 cut(s) 248, 295, 348
Alw26I GTCTC 1 cut(s) 280
AlwI GGATC 3 cut(s) 120, 179, 192
AoxI GGCC 1 cut(s) 25
ApoI RAATTY 1 cut(s) 19
BamHI GGATCC 1 cut(s) 184
BbsI GAAGAC 1 cut(s) 15
BccI CCATC 3 cut(s) 35, 98, 170
BcoDI GTCTC 1 cut(s) 280
BfaI CTAG 2 cut(s) 312, 367
BfmI CTRYAG 1 cut(s) 48
BmiI GGNNCC 1 cut(s) 186
BmsI GCATC 1 cut(s) 232
BpiI GAAGAC 1 cut(s) 15
BsaJI CCNNGG 2 cut(s) 82, 154
BseDI CCNNGG 2 cut(s) 82, 154
BseGI GGATG 2 cut(s) 46, 266
BshFI GGCC 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 280
BsnI GGCC 1 cut(s) 27
Bsp143I GATC 2 cut(s) 112, 184
BspANI GGCC 1 cut(s) 27
BspHI TCATGA 3 cut(s) 94, 115, 238
BspLI GGNNCC 1 cut(s) 186
BspPI GGATC 3 cut(s) 120, 179, 192
BssECI CCNNGG 2 cut(s) 82, 154
BssMI GATC 2 cut(s) 112, 184
BssT1I CCWWGG 2 cut(s) 82, 154
Bst6I CTCTTC 1 cut(s) 278
BstC8I GCNNGC 1 cut(s) 250
BstDEI CTNAG 1 cut(s) 253
BstF5I GGATG 2 cut(s) 46, 266
BstKTI GATC 2 cut(s) 115, 187
BstMAI GTCTC 1 cut(s) 280
BstMBI GATC 2 cut(s) 112, 184
BstSFI CTRYAG 1 cut(s) 48
BstV2I GAAGAC 1 cut(s) 15
BstX2I RGATCY 1 cut(s) 184
BstYI RGATCY 1 cut(s) 184
BsuRI GGCC 1 cut(s) 27
BtsCI GGATG 2 cut(s) 46, 266
Cac8I GCNNGC 1 cut(s) 250
CciI TCATGA 3 cut(s) 94, 115, 238
CviAII CATG 5 cut(s) 29, 65, 95, 116, 239
CviJI RGCY 6 cut(s) 27, 248, 252, 295, 307, 348
CviKI_1 RGCY 6 cut(s) 27, 248, 252, 295, 307, 348
DdeI CTNAG 1 cut(s) 253
DpnI GATC 2 cut(s) 114, 186
DpnII GATC 2 cut(s) 112, 184
Eam1104I CTCTTC 1 cut(s) 278
EarI CTCTTC 1 cut(s) 278
Eco130I CCWWGG 2 cut(s) 82, 154
EcoRI GAATTC 1 cut(s) 19
EcoT14I CCWWGG 2 cut(s) 82, 154
ErhI CCWWGG 2 cut(s) 82, 154
FaeI CATG 5 cut(s) 32, 68, 98, 119, 242
FaiI YATR 8 cut(s) 30, 66, 96, 117, 240, 261, 299, 364
FatI CATG 5 cut(s) 28, 64, 94, 115, 238
FokI GGATG 2 cut(s) 53, 253
FspBI CTAG 2 cut(s) 312, 367
HaeIII GGCC 1 cut(s) 27
Hin1II CATG 5 cut(s) 32, 68, 98, 119, 242
HindIII AAGCTT 1 cut(s) 293
HinfI GANTC 7 cut(s) 91, 128, 163, 200, 235, 272, 326
Hpy166II GTNNAC 1 cut(s) 333
Hpy188I TCNGA 7 cut(s) 76, 127, 148, 199, 271, 277, 343
Hpy188III TCNNGA 6 cut(s) 59, 95, 116, 167, 188, 239
Hpy8I GTNNAC 1 cut(s) 333
HpyF3I CTNAG 1 cut(s) 253
Hsp92II CATG 5 cut(s) 32, 68, 98, 119, 242
Kzo9I GATC 2 cut(s) 112, 184
LpnPI CCDG 5 cut(s) 9, 27, 201, 204, 234
LweI GCATC 1 cut(s) 232
MaeI CTAG 2 cut(s) 312, 367
MalI GATC 2 cut(s) 114, 186
MboI GATC 2 cut(s) 112, 184
MboII GAAGA 6 cut(s) 20, 113, 151, 185, 223, 295
MflI RGATCY 1 cut(s) 184
MluCI AATT 3 cut(s) 19, 133, 205
MlyI GAGTC 4 cut(s) 122, 194, 266, 335
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 2 cut(s) 31, 352
NdeII GATC 2 cut(s) 112, 184
NlaIII CATG 5 cut(s) 32, 68, 98, 119, 242
NlaIV GGNNCC 1 cut(s) 186
PagI TCATGA 3 cut(s) 94, 115, 238
PfeI GAWTC 3 cut(s) 91, 163, 235
PleI GAGTC 4 cut(s) 122, 194, 266, 334
PpsI GAGTC 4 cut(s) 122, 194, 266, 334
PspN4I GGNNCC 1 cut(s) 186
PsuI RGATCY 1 cut(s) 184
Sau3AI GATC 2 cut(s) 112, 184
SchI GAGTC 4 cut(s) 122, 194, 266, 335
SetI ASST 6 cut(s) 84, 156, 250, 297, 350, 363
SfaNI GCATC 1 cut(s) 232
SfcI CTRYAG 1 cut(s) 48
Sse9I AATT 3 cut(s) 19, 133, 205
SspMI CTAG 2 cut(s) 312, 367
StyI CCWWGG 2 cut(s) 82, 154
TaqI TCGA 1 cut(s) 229
TasI AATT 3 cut(s) 19, 133, 205
TfiI GAWTC 3 cut(s) 91, 163, 235
TspDTI ATGAA 8 cut(s) 17, 83, 114, 132, 186, 227, 258, 276
XapI RAATTY 1 cut(s) 19
XspI CTAG 2 cut(s) 312, 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.