Rh5AG057200

At4g04980-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
4952989 .. 4953740
752 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG057200.1

Sequence Viewer

Length: 540 bp
ATGAAACTGCAGGTTTTATCAAGGTTTGAAGGATTCCCTACAAAAAAGTTAGAAACAATGAGGGCAGCAGTAGCACTCCACTCACAACTAAATGCAATGATCACTGAACTACACAATTGGAAAATAGAGGCTCCACTAGGTCCTCTCCTTGACAAGATTGAACGTTATTTCACCAAGATCAAAGGAGAAATAGATAAACTGGAGCGAACAAAAGATGAAGAAATTAAGAAATTTAAGAGTCAAAATATCCACTTTGATTTCAATATCCTCATCCGGATAAAAGAAGCAATGGTGGATGTTTCCTCAGGCTGCATGGAGCTGGCACTAAAGGAAAGAAGAAAAGCAAAGGCCAGTGGAGTGGCACAAACTACTGGAACCAAAACTGATAAAAAGCAATTAAAGATATGCATTAAAATGCTGTGGAGGGCTTTTCAGTTTGCCTTCAAGGTCTATACCTTTGCTGGTGGACACGATGATCGTGCCGACATGCTCACAAGAGAACTAGCTACTGAAATTGAGTCTGACCCCTACCAGCACTGA

Protein Analysis

179

Amino Acids

20.71

Weight (kDa)

9.35

Isoelectric Point (pI)

35.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 273
AclI AACGTT 1 cut(s) 163
AcsI RAATTY 1 cut(s) 230
AgsI TTSAA 4 cut(s) 29, 161, 262, 445
AluBI AGCT 2 cut(s) 319, 506
AluI AGCT 2 cut(s) 319, 506
Aor13HI TCCGGA 1 cut(s) 273
AoxI GGCC 1 cut(s) 348
ApeKI GCWGC 2 cut(s) 65, 309
ApoI RAATTY 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 163
AvaII GGWCC 1 cut(s) 140
AxyI CCTNAGG 1 cut(s) 304
BbvI GCAGC 2 cut(s) 77, 296
BcgI CGANNNNNNTGC 2 cut(s) 461, 495
BclI TGATCA 1 cut(s) 99
BfaI CTAG 2 cut(s) 137, 503
BfmI CTRYAG 1 cut(s) 8
BisI GCNGC 2 cut(s) 66, 310
BlsI GCNGC 2 cut(s) 67, 311
Bme18I GGWCC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 140
BmiI GGNNCC 2 cut(s) 132, 376
BpmI CTGGAG 1 cut(s) 221
BsaWI WCCGGW 1 cut(s) 273
Bse1I ACTGG 3 cut(s) 204, 351, 376
Bse21I CCTNAGG 1 cut(s) 304
Bse3DI GCAATG 2 cut(s) 102, 294
BseAI TCCGGA 1 cut(s) 273
BseGI GGATG 2 cut(s) 270, 301
BseMI GCAATG 2 cut(s) 102, 294
BseMII CTCAG 1 cut(s) 318
BseNI ACTGG 3 cut(s) 204, 351, 376
BseXI GCAGC 2 cut(s) 77, 296
BshFI GGCC 1 cut(s) 350
BsiSI CCGG 1 cut(s) 274
BsnI GGCC 1 cut(s) 350
Bsp13I TCCGGA 1 cut(s) 273
Bsp143I GATC 3 cut(s) 99, 177, 475
BspANI GGCC 1 cut(s) 350
BspCNI CTCAG 1 cut(s) 317
BspEI TCCGGA 1 cut(s) 273
BspLI GGNNCC 2 cut(s) 132, 376
BspMAI CTGCAG 1 cut(s) 12
BsrDI GCAATG 2 cut(s) 102, 294
BsrI ACTGG 3 cut(s) 204, 351, 376
BssMI GATC 3 cut(s) 99, 177, 475
BstC8I GCNNGC 1 cut(s) 321
BstDEI CTNAG 1 cut(s) 304
BstF5I GGATG 2 cut(s) 270, 301
BstKTI GATC 3 cut(s) 102, 180, 478
BstMBI GATC 3 cut(s) 99, 177, 475
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstNSI RCATGY 1 cut(s) 490
BstSFI CTRYAG 1 cut(s) 8
BstV1I GCAGC 2 cut(s) 77, 296
BstXI CCANNNNNNTGG 1 cut(s) 358
Bsu36I CCTNAGG 1 cut(s) 304
BsuRI GGCC 1 cut(s) 350
BtsCI GGATG 2 cut(s) 270, 301
BtsIMutI CAGTG 3 cut(s) 102, 358, 535
Cac8I GCNNGC 1 cut(s) 321
Cfr13I GGNCC 1 cut(s) 140
CviAII CATG 2 cut(s) 313, 487
CviJI RGCY 6 cut(s) 131, 309, 319, 350, 428, 506
CviKI_1 RGCY 6 cut(s) 131, 309, 319, 350, 428, 506
DdeI CTNAG 1 cut(s) 304
DpnI GATC 3 cut(s) 101, 179, 477
DpnII GATC 3 cut(s) 99, 177, 475
Eco47I GGWCC 1 cut(s) 140
Eco81I CCTNAGG 1 cut(s) 304
EcoO109I RGGNCCY 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 410
FaeI CATG 2 cut(s) 316, 490
FaiI YATR 4 cut(s) 314, 406, 453, 488
FatI CATG 2 cut(s) 312, 486
FbaI TGATCA 1 cut(s) 99
Fnu4HI GCNGC 2 cut(s) 66, 310
FokI GGATG 2 cut(s) 257, 308
Fsp4HI GCNGC 2 cut(s) 66, 310
FspBI CTAG 2 cut(s) 137, 503
GluI GCNGC 2 cut(s) 66, 310
GsuI CTGGAG 1 cut(s) 221
HaeIII GGCC 1 cut(s) 350
HapII CCGG 1 cut(s) 274
Hin1II CATG 2 cut(s) 316, 490
HinfI GANTC 3 cut(s) 33, 238, 518
HpaII CCGG 1 cut(s) 274
HphI GGTGA 1 cut(s) 163
Hpy166II GTNNAC 1 cut(s) 467
Hpy188I TCNGA 1 cut(s) 523
Hpy188III TCNNGA 1 cut(s) 274
Hpy8I GTNNAC 1 cut(s) 467
HpyAV CCTTC 2 cut(s) 23, 451
HpyCH4IV ACGT 1 cut(s) 163
HpyCH4V TGCA 4 cut(s) 10, 95, 312, 408
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 304
HpySE526I ACGT 1 cut(s) 163
Hsp92II CATG 2 cut(s) 316, 490
Kpn2I TCCGGA 1 cut(s) 273
Ksp22I TGATCA 1 cut(s) 99
Kzo9I GATC 3 cut(s) 99, 177, 475
LmnI GCTCC 3 cut(s) 136, 202, 316
LpnPI CCDG 7 cut(s) 185, 287, 291, 305, 357, 364, 447
Lsp1109I GCAGC 2 cut(s) 77, 296
MaeI CTAG 2 cut(s) 137, 503
MaeII ACGT 1 cut(s) 163
MalI GATC 3 cut(s) 101, 179, 477
MboI GATC 3 cut(s) 99, 177, 475
MboII GAAGA 2 cut(s) 230, 348
MfeI CAATTG 1 cut(s) 115
MluCI AATT 5 cut(s) 115, 222, 230, 395, 513
MlyI GAGTC 2 cut(s) 247, 527
MnlI CCTC 6 cut(s) 54, 121, 153, 278, 313, 417
Mph1103I ATGCAT 1 cut(s) 410
MroI TCCGGA 1 cut(s) 273
MseI TTAA 4 cut(s) 225, 234, 398, 411
MslI CAYNNNNRTG 1 cut(s) 413
MspI CCGG 1 cut(s) 274
MunI CAATTG 1 cut(s) 115
MwoI GCNNNNNNNGC 1 cut(s) 71
NdeII GATC 3 cut(s) 99, 177, 475
NlaIII CATG 2 cut(s) 316, 490
NlaIV GGNNCC 2 cut(s) 132, 376
NsiI ATGCAT 1 cut(s) 410
NspI RCATGY 1 cut(s) 490
PfeI GAWTC 1 cut(s) 33
PkrI GCNGC 2 cut(s) 67, 311
PleI GAGTC 2 cut(s) 246, 526
PpsI GAGTC 2 cut(s) 246, 526
PpuMI RGGWCCY 1 cut(s) 140
Psp1406I AACGTT 1 cut(s) 163
Psp5II RGGWCCY 1 cut(s) 140
PspN4I GGNNCC 2 cut(s) 132, 376
PspPI GGNCC 1 cut(s) 140
PspPPI RGGWCCY 1 cut(s) 140
PstI CTGCAG 1 cut(s) 12
RseI CAYNNNNRTG 1 cut(s) 413
SaqAI TTAA 4 cut(s) 225, 234, 398, 411
SatI GCNGC 2 cut(s) 66, 310
Sau3AI GATC 3 cut(s) 99, 177, 475
Sau96I GGNCC 1 cut(s) 140
SchI GAGTC 2 cut(s) 247, 527
SetI ASST 8 cut(s) 15, 26, 142, 166, 321, 450, 458, 508
SfcI CTRYAG 1 cut(s) 8
SinI GGWCC 1 cut(s) 140
SmiMI CAYNNNNRTG 1 cut(s) 413
Sse9I AATT 5 cut(s) 115, 222, 230, 395, 513
SspMI CTAG 2 cut(s) 137, 503
TaiI ACGT 1 cut(s) 166
TasI AATT 5 cut(s) 115, 222, 230, 395, 513
TfiI GAWTC 1 cut(s) 33
Tru1I TTAA 4 cut(s) 225, 234, 398, 411
Tru9I TTAA 4 cut(s) 225, 234, 398, 411
TscAI CASTG 2 cut(s) 109, 358
TseI GCWGC 2 cut(s) 65, 309
TspDTI ATGAA 2 cut(s) 17, 231
TspRI CASTG 2 cut(s) 109, 358
VpaK11BI GGWCC 1 cut(s) 140
XapI RAATTY 1 cut(s) 230
XceI RCATGY 1 cut(s) 490
XspI CTAG 2 cut(s) 137, 503
Zsp2I ATGCAT 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.