Rh5DG055000

Importin-5-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
4694330 .. 4695235
906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG055000.1

Sequence Viewer

Length: 258 bp
ATGAGCATTGTAATACCTCCTTTGCTTCAGTTTGCTCAACTTAAGCCAGATGAAACTATTACCTCCGCAAATGACAATAGTGATATTGATGAATATGATGACGAAAGTATGGAAACAATTACTCTTGGAGACAAAAGGATTAGAATCAAGAGTAGTGTATTGGAGGAAAAAGTCGCAGCTTACAATTTGCTGTGTTACTATGCTGATGAATTGAAAGAAGGATTCTTTCCGTGGATTGATCAGCAATGCGGAATCTGA

Protein Analysis

85

Amino Acids

9.71

Weight (kDa)

4.1

Isoelectric Point (pI)

32.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 66, 249
AcuI CTGAAG 1 cut(s) 11
AflII CTTAAG 1 cut(s) 41
AgsI TTSAA 1 cut(s) 214
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
Alw26I GTCTC 1 cut(s) 123
ApeKI GCWGC 1 cut(s) 176
BbvI GCAGC 1 cut(s) 188
BclI TGATCA 1 cut(s) 238
BcoDI GTCTC 1 cut(s) 123
BfrI CTTAAG 1 cut(s) 41
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
BsaBI GATNNNNATC 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 251
Bse8I GATNNNNATC 1 cut(s) 143
BseDI CCNNGG 1 cut(s) 230
BseJI GATNNNNATC 1 cut(s) 143
BseMI GCAATG 1 cut(s) 251
BseXI GCAGC 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 123
Bsp143I GATC 1 cut(s) 238
BspACI CCGC 2 cut(s) 66, 249
BspTI CTTAAG 1 cut(s) 41
BsrDI GCAATG 1 cut(s) 251
BssECI CCNNGG 1 cut(s) 230
BssMI GATC 1 cut(s) 238
BstAFI CTTAAG 1 cut(s) 41
BstDSI CCRYGG 1 cut(s) 230
BstKTI GATC 1 cut(s) 241
BstMAI GTCTC 1 cut(s) 123
BstMBI GATC 1 cut(s) 238
BstV1I GCAGC 1 cut(s) 188
BtgI CCRYGG 1 cut(s) 230
CviJI RGCY 2 cut(s) 46, 179
CviKI_1 RGCY 2 cut(s) 46, 179
DpnI GATC 1 cut(s) 240
DpnII GATC 1 cut(s) 238
Eco57I CTGAAG 1 cut(s) 11
FaiI YATR 3 cut(s) 96, 110, 201
FbaI TGATCA 1 cut(s) 238
Fnu4HI GCNGC 1 cut(s) 177
Fsp4HI GCNGC 1 cut(s) 177
GluI GCNGC 1 cut(s) 177
HinfI GANTC 3 cut(s) 144, 222, 252
Hpy188I TCNGA 1 cut(s) 257
Hpy188III TCNNGA 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 212
Ksp22I TGATCA 1 cut(s) 238
Kzo9I GATC 1 cut(s) 238
LpnPI CCDG 1 cut(s) 60
Lsp1109I GCAGC 1 cut(s) 188
MaeIII GTNAC 1 cut(s) 194
MalI GATC 1 cut(s) 240
MboI GATC 1 cut(s) 238
MluCI AATT 3 cut(s) 117, 184, 209
MnlI CCTC 3 cut(s) 27, 73, 157
MseI TTAA 1 cut(s) 42
MspCI CTTAAG 1 cut(s) 41
NdeII GATC 1 cut(s) 238
PfeI GAWTC 3 cut(s) 144, 222, 252
PkrI GCNGC 1 cut(s) 178
SaqAI TTAA 1 cut(s) 42
SatI GCNGC 1 cut(s) 177
Sau3AI GATC 1 cut(s) 238
SetI ASST 3 cut(s) 19, 65, 181
SgeI CNNG 4 cut(s) 59, 137, 160, 243
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 3 cut(s) 117, 184, 209
SsiI CCGC 2 cut(s) 66, 249
TasI AATT 3 cut(s) 117, 184, 209
TfiI GAWTC 3 cut(s) 144, 222, 252
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TseI GCWGC 1 cut(s) 176
TspDTI ATGAA 3 cut(s) 66, 105, 222
TspGWI ACGGA 1 cut(s) 219
Vha464I CTTAAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.