Rh5DG552400

Protein terminal ear1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0009740
Physical Location & Seq
Reverse (-)
85155839 .. 85156168
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG552400.1

Sequence Viewer

Length: 330 bp
ATGGGAAGAAGTATCCAACTAGAAAGGAGTACATGCAGAGCCGCTGAGCACCAAGCTCTGGATCCGACGGCAGTCCACGACTTCAAAGAGTTCTCGGATCTGTCCGAGGAGGCATTCGGCCAGGTGAGGTGGGTTCAGACGGAGAGGTCCTGTGATGGGATCGTGACCGTCCATTTTGACGATCTCAGGTATGCAGAGAAGGCCTTGGCGGAGAAGAGGTTGCCAAGGTGTGTTACTGTGTTTGGGTATGGGGTTACTCTTGGATTTGGGAGTGTGAATTTGGAGAGGTGGAGGAATTTTGTGGGGAGGATTGGCTCTAGATTAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1 RRM_2

Protein Analysis

109

Amino Acids

12.41

Weight (kDa)

6.82

Isoelectric Point (pI)

41.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 145
AccB7I CCANNNNNTGG 1 cut(s) 58
AciI CCGC 2 cut(s) 42, 209
AclWI GGATC 4 cut(s) 56, 69, 105, 167
AcoI YGGCCR 1 cut(s) 118
AcsI RAATTY 2 cut(s) 277, 295
AfaI GTAC 1 cut(s) 31
AfiI CCNNNNNNNGG 2 cut(s) 58, 156
AgsI TTSAA 1 cut(s) 85
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
Alw21I GWGCWC 1 cut(s) 51
AlwI GGATC 4 cut(s) 56, 69, 105, 167
AoxI GGCC 2 cut(s) 118, 201
ApoI RAATTY 2 cut(s) 277, 295
AspS9I GGNCC 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 136
AvaII GGWCC 1 cut(s) 147
BamHI GGATCC 1 cut(s) 61
Bbv12I GWGCWC 1 cut(s) 51
BccI CCATC 1 cut(s) 149
BceAI ACGGC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 122
BciVI GTATCC 1 cut(s) 23
BfaI CTAG 2 cut(s) 20, 318
BfuI GTATCC 1 cut(s) 23
BisI GCNGC 1 cut(s) 42
BlpI GCTNAGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 43
Bme1390I CCNGG 1 cut(s) 122
Bme18I GGWCC 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 147
BmiI GGNNCC 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 122
BoxI GACNNNNGTC 1 cut(s) 71
Bpu1102I GCTNAGC 1 cut(s) 45
BsaJI CCNNGG 3 cut(s) 105, 204, 224
BsaXI ACNNNNNCTCC 2 cut(s) 203, 233
Bsc4I CCNNNNNNNGG 2 cut(s) 58, 156
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 3 cut(s) 105, 204, 224
BseLI CCNNNNNNNGG 2 cut(s) 58, 156
BseMII CTCAG 2 cut(s) 36, 199
BseRI GAGGAG 1 cut(s) 122
BshFI GGCC 2 cut(s) 120, 203
BsiHKAI GWGCWC 1 cut(s) 51
BslI CCNNNNNNNGG 2 cut(s) 58, 156
BsmI GAATGC 1 cut(s) 113
BsnI GGCC 2 cut(s) 120, 203
Bsp1286I GDGCHC 1 cut(s) 51
Bsp143I GATC 4 cut(s) 61, 97, 159, 181
Bsp1720I GCTNAGC 1 cut(s) 45
BspACI CCGC 2 cut(s) 42, 209
BspANI GGCC 2 cut(s) 120, 203
BspCNI CTCAG 2 cut(s) 37, 198
BspLI GGNNCC 1 cut(s) 63
BspPI GGATC 4 cut(s) 56, 69, 105, 167
BssECI CCNNGG 3 cut(s) 105, 204, 224
BssMI GATC 4 cut(s) 61, 97, 159, 181
BssT1I CCWWGG 2 cut(s) 204, 224
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 2 cut(s) 169, 238
Bst6I CTCTTC 1 cut(s) 209
BstDEI CTNAG 2 cut(s) 45, 185
BstKTI GATC 4 cut(s) 64, 100, 162, 184
BstMBI GATC 4 cut(s) 61, 97, 159, 181
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstNI CCWGG 1 cut(s) 122
BstNSI RCATGY 1 cut(s) 36
BstPAI GACNNNNGTC 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 120
BstX2I RGATCY 2 cut(s) 61, 97
BstYI RGATCY 2 cut(s) 61, 97
BsuI GTATCC 1 cut(s) 23
BsuRI GGCC 2 cut(s) 120, 203
Cfr13I GGNCC 1 cut(s) 147
Csp6I GTAC 1 cut(s) 30
CviAII CATG 1 cut(s) 33
CviJI RGCY 5 cut(s) 41, 56, 120, 203, 315
CviKI_1 RGCY 5 cut(s) 41, 56, 120, 203, 315
CviQI GTAC 1 cut(s) 30
DdeI CTNAG 2 cut(s) 45, 185
DpnI GATC 4 cut(s) 63, 99, 161, 183
DpnII GATC 4 cut(s) 61, 97, 159, 181
DrdI GACNNNNNNGTC 1 cut(s) 145
DseDI GACNNNNNNGTC 1 cut(s) 145
EaeI YGGCCR 1 cut(s) 118
Eam1104I CTCTTC 1 cut(s) 209
EarI CTCTTC 1 cut(s) 209
EciI GGCGGA 1 cut(s) 224
Eco130I CCWWGG 2 cut(s) 204, 224
Eco147I AGGCCT 1 cut(s) 203
Eco47I GGWCC 1 cut(s) 147
EcoO109I RGGNCCY 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 120
EcoT14I CCWWGG 2 cut(s) 204, 224
ErhI CCWWGG 2 cut(s) 204, 224
FaeI CATG 1 cut(s) 36
FaiI YATR 3 cut(s) 34, 192, 249
FatI CATG 1 cut(s) 32
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
FspBI CTAG 2 cut(s) 20, 318
GluI GCNGC 1 cut(s) 42
HaeIII GGCC 2 cut(s) 120, 203
Hin1II CATG 1 cut(s) 36
HphI GGTGA 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 4 cut(s) 66, 97, 106, 138
Hpy188III TCNNGA 3 cut(s) 59, 163, 318
Hpy8I GTNNAC 1 cut(s) 76
Hpy99I CGWCG 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 193
HpyCH4III ACNGT 2 cut(s) 169, 238
HpyCH4V TGCA 2 cut(s) 36, 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
HpyF3I CTNAG 2 cut(s) 45, 185
Hsp92II CATG 1 cut(s) 36
Kzo9I GATC 4 cut(s) 61, 97, 159, 181
LpnPI CCDG 5 cut(s) 44, 107, 134, 163, 172
MaeI CTAG 2 cut(s) 20, 318
MaeIII GTNAC 3 cut(s) 163, 232, 253
MalI GATC 4 cut(s) 63, 99, 161, 183
MboI GATC 4 cut(s) 61, 97, 159, 181
MboII GAAGA 2 cut(s) 18, 226
MflI RGATCY 2 cut(s) 61, 97
MhlI GDGCHC 1 cut(s) 51
MluCI AATT 3 cut(s) 277, 295, 325
MmeI TCCRAC 2 cut(s) 40, 89
MnlI CCTC 8 cut(s) 100, 103, 120, 138, 210, 279, 285, 300
MseI TTAA 2 cut(s) 323, 328
MspA1I CMGCKG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 122
Mva1269I GAATGC 1 cut(s) 113
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 200
NdeII GATC 4 cut(s) 61, 97, 159, 181
NlaIII CATG 1 cut(s) 36
NlaIV GGNNCC 1 cut(s) 63
NmuCI GTSAC 1 cut(s) 163
NspI RCATGY 1 cut(s) 36
PceI AGGCCT 1 cut(s) 203
PctI GAATGC 1 cut(s) 113
PflMI CCANNNNNTGG 1 cut(s) 58
PkrI GCNGC 1 cut(s) 43
PpuMI RGGWCCY 1 cut(s) 147
PshAI GACNNNNGTC 1 cut(s) 71
Psp5II RGGWCCY 1 cut(s) 147
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PspN4I GGNNCC 1 cut(s) 63
PspPI GGNCC 1 cut(s) 147
PspPPI RGGWCCY 1 cut(s) 147
PsuI RGATCY 2 cut(s) 61, 97
RsaI GTAC 1 cut(s) 31
RsaNI GTAC 1 cut(s) 30
SaqAI TTAA 2 cut(s) 323, 328
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 4 cut(s) 61, 97, 159, 181
Sau96I GGNCC 1 cut(s) 147
ScrFI CCNGG 1 cut(s) 122
SduI GDGCHC 1 cut(s) 51
SetI ASST 8 cut(s) 58, 126, 131, 149, 191, 221, 230, 290
SinI GGWCC 1 cut(s) 147
Sse9I AATT 3 cut(s) 277, 295, 325
SseBI AGGCCT 1 cut(s) 203
SsiI CCGC 2 cut(s) 42, 209
SspMI CTAG 2 cut(s) 20, 318
StuI AGGCCT 1 cut(s) 203
StyD4I CCNGG 1 cut(s) 120
StyI CCWWGG 2 cut(s) 204, 224
TaaI ACNGT 2 cut(s) 169, 238
TasI AATT 3 cut(s) 277, 295, 325
TatI WGTACW 1 cut(s) 29
TauI GCSGC 1 cut(s) 44
Tru1I TTAA 2 cut(s) 323, 328
Tru9I TTAA 2 cut(s) 323, 328
TseFI GTSAC 1 cut(s) 163
Tsp45I GTSAC 1 cut(s) 163
TspGWI ACGGA 1 cut(s) 155
Van91I CCANNNNNTGG 1 cut(s) 58
VpaK11BI GGWCC 1 cut(s) 147
XapI RAATTY 2 cut(s) 277, 295
XbaI TCTAGA 1 cut(s) 317
XceI RCATGY 1 cut(s) 36
XspI CTAG 2 cut(s) 20, 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.