Rh6AG177700

helicase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0005832
Physical Location & Seq
Forward (+)
28784460 .. 28784825
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG177700.1

Sequence Viewer

Length: 366 bp
ATGGGCGGCGGGCCCAGAACCTTCCCCGGCGGTGTATATAAGTGGCAGTGGAAGCGCATGCAGGCCAGGAAAGCCAAGCAGCTCCTCAAGGCCCGCCTCTGCCGTGAGAGCCAAATCTACAAGATACAAGGCGGGCCGAGCTCAAAGCCGCTGTGTCGGAGCTCGAGGGAGACCGTCGAGAAGCCTCCCAATTTGTTCTCCATCAGCGCTGATGGGCAGGTTAAGGTCTTGGCCGATCAGTTCCAGAGGCCGGGAGGGTTTGACTTGTGGACTGAGAGGAATGGGCCAGAGCTGTTTCGGACCATGGAGGACCTGCCGTCGGCGAGGTTTTTTCCCAAGGGGGTTGTGCATAGTGAGGCCGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.68

Weight (kDa)

10.14

Isoelectric Point (pI)

42.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 208, 321
AciI CCGC 6 cut(s) 6, 9, 30, 94, 132, 149
AcoI YGGCCR 1 cut(s) 231
AfeI AGCGCT 1 cut(s) 208
AfiI CCNNNNNNNGG 2 cut(s) 250, 319
AhdI GACNNNNNGTC 1 cut(s) 316
AjnI CCWGG 1 cut(s) 65
AluBI AGCT 4 cut(s) 82, 141, 162, 292
AluI AGCT 4 cut(s) 82, 141, 162, 292
Alw21I GWGCWC 2 cut(s) 143, 164
Alw26I GTCTC 1 cut(s) 164
Ama87I CYCGRG 1 cut(s) 163
Aor51HI AGCGCT 1 cut(s) 208
AoxI GGCC 8 cut(s) 11, 63, 90, 134, 231, 248, 284, 357
ApaI GGGCCC 1 cut(s) 15
ApeKI GCWGC 1 cut(s) 79
AspLEI GCGC 2 cut(s) 57, 209
AspS9I GGNCC 7 cut(s) 11, 12, 91, 134, 284, 300, 310
AsuC2I CCSGG 2 cut(s) 27, 252
AvaI CYCGRG 1 cut(s) 163
AvaII GGWCC 2 cut(s) 300, 310
BaeGI GKGCMC 1 cut(s) 15
BanII GRGCYC 3 cut(s) 15, 143, 164
Bbv12I GWGCWC 2 cut(s) 143, 164
BbvI GCAGC 1 cut(s) 91
BccI CCATC 2 cut(s) 206, 209
BceAI ACGGC 3 cut(s) 87, 301, 344
BciT130I CCWGG 1 cut(s) 67
BcnI CCSGG 2 cut(s) 27, 252
BcoDI GTCTC 1 cut(s) 164
BfoI RGCGCY 1 cut(s) 210
BfuAI ACCTGC 2 cut(s) 208, 321
BisI GCNGC 3 cut(s) 7, 80, 149
BlsI GCNGC 3 cut(s) 8, 81, 150
Bme1390I CCNGG 3 cut(s) 27, 67, 252
Bme18I GGWCC 2 cut(s) 300, 310
BmeRI GACNNNNNGTC 1 cut(s) 316
BmeT110I CYCGRG 1 cut(s) 163
BmgT120I GGNCC 7 cut(s) 11, 12, 91, 134, 284, 300, 310
BmiI GGNNCC 1 cut(s) 13
BmrFI CCNGG 3 cut(s) 27, 67, 252
BpuEI CTTGAG 1 cut(s) 71
BpuMI CCSGG 2 cut(s) 27, 252
BsaI GGTCTC 1 cut(s) 164
BsaJI CCNNGG 3 cut(s) 25, 303, 336
Bsc4I CCNNNNNNNGG 2 cut(s) 250, 319
BseBI CCWGG 1 cut(s) 67
BseDI CCNNGG 3 cut(s) 25, 303, 336
BseLI CCNNNNNNNGG 2 cut(s) 250, 319
BseMII CTCAG 1 cut(s) 264
BseRI GAGGAG 1 cut(s) 74
BseSI GKGCMC 1 cut(s) 15
BseXI GCAGC 1 cut(s) 91
BshFI GGCC 8 cut(s) 13, 65, 92, 136, 233, 250, 286, 359
BsiHKAI GWGCWC 2 cut(s) 143, 164
BsiHKCI CYCGRG 1 cut(s) 163
BsiSI CCGG 2 cut(s) 27, 251
BslI CCNNNNNNNGG 2 cut(s) 250, 319
BsmAI GTCTC 1 cut(s) 164
BsnI GGCC 8 cut(s) 13, 65, 92, 136, 233, 250, 286, 359
Bso31I GGTCTC 1 cut(s) 164
BsoBI CYCGRG 1 cut(s) 163
Bsp120I GGGCCC 1 cut(s) 11
Bsp1286I GDGCHC 3 cut(s) 15, 143, 164
Bsp143I GATC 1 cut(s) 235
Bsp19I CCATGG 1 cut(s) 303
BspACI CCGC 6 cut(s) 6, 9, 30, 94, 132, 149
BspANI GGCC 8 cut(s) 13, 65, 92, 136, 233, 250, 286, 359
BspCNI CTCAG 1 cut(s) 265
BspLI GGNNCC 1 cut(s) 13
BspMI ACCTGC 2 cut(s) 208, 321
BspTNI GGTCTC 1 cut(s) 164
BssECI CCNNGG 3 cut(s) 25, 303, 336
BssMI GATC 1 cut(s) 235
BssT1I CCWWGG 2 cut(s) 303, 336
Bst2UI CCWGG 1 cut(s) 67
Bst4CI ACNGT 1 cut(s) 175
BstC8I GCNNGC 5 cut(s) 11, 59, 63, 94, 134
BstDEI CTNAG 1 cut(s) 273
BstDSI CCRYGG 1 cut(s) 303
BstH2I RGCGCY 1 cut(s) 210
BstHHI GCGC 2 cut(s) 57, 209
BstKTI GATC 1 cut(s) 238
BstMAI GTCTC 1 cut(s) 164
BstMBI GATC 1 cut(s) 235
BstMWI GCNNNNNNNGC 4 cut(s) 52, 71, 108, 138
BstNI CCWGG 1 cut(s) 67
BstNSI RCATGY 1 cut(s) 61
BstSCI CCNGG 3 cut(s) 25, 65, 250
BstSLI GKGCMC 1 cut(s) 15
BstV1I GCAGC 1 cut(s) 91
BsuRI GGCC 8 cut(s) 13, 65, 92, 136, 233, 250, 286, 359
BtgI CCRYGG 1 cut(s) 303
BtsI GCAGTG 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 53
BveI ACCTGC 2 cut(s) 208, 321
Cac8I GCNNGC 5 cut(s) 11, 59, 63, 94, 134
CfoI GCGC 2 cut(s) 57, 209
Cfr13I GGNCC 7 cut(s) 11, 12, 91, 134, 284, 300, 310
CviAII CATG 2 cut(s) 58, 304
DdeI CTNAG 1 cut(s) 273
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
DriI GACNNNNNGTC 1 cut(s) 316
EaeI YGGCCR 1 cut(s) 231
Eam1105I GACNNNNNGTC 1 cut(s) 316
Ecl136II GAGCTC 2 cut(s) 141, 162
Eco130I CCWWGG 2 cut(s) 303, 336
Eco24I GRGCYC 3 cut(s) 15, 143, 164
Eco31I GGTCTC 1 cut(s) 164
Eco47I GGWCC 2 cut(s) 300, 310
Eco47III AGCGCT 1 cut(s) 208
Eco53kI GAGCTC 2 cut(s) 141, 162
Eco88I CYCGRG 1 cut(s) 163
EcoICRI GAGCTC 2 cut(s) 141, 162
EcoO109I RGGNCCY 1 cut(s) 310
EcoRII CCWGG 1 cut(s) 65
EcoT14I CCWWGG 2 cut(s) 303, 336
EcoT38I GRGCYC 3 cut(s) 15, 143, 164
ErhI CCWWGG 2 cut(s) 303, 336
FaeI CATG 2 cut(s) 61, 307
FaiI YATR 6 cut(s) 37, 39, 59, 305, 351, 364
FatI CATG 2 cut(s) 57, 303
FauI CCCGC 3 cut(s) 2, 101, 125
Fnu4HI GCNGC 3 cut(s) 7, 80, 149
FriOI GRGCYC 3 cut(s) 15, 143, 164
Fsp4HI GCNGC 3 cut(s) 7, 80, 149
GlaI GCGC 2 cut(s) 56, 208
GluI GCNGC 3 cut(s) 7, 80, 149
HaeII RGCGCY 1 cut(s) 210
HaeIII GGCC 8 cut(s) 13, 65, 92, 136, 233, 250, 286, 359
HapII CCGG 2 cut(s) 27, 251
HhaI GCGC 2 cut(s) 57, 209
Hin1II CATG 2 cut(s) 61, 307
Hin6I GCGC 2 cut(s) 55, 207
HinP1I GCGC 2 cut(s) 55, 207
HpaII CCGG 2 cut(s) 27, 251
Hpy166II GTNNAC 1 cut(s) 270
Hpy188I TCNGA 2 cut(s) 159, 300
Hpy188III TCNNGA 2 cut(s) 178, 244
Hpy8I GTNNAC 1 cut(s) 270
Hpy99I CGWCG 2 cut(s) 179, 322
HpyAV CCTTC 1 cut(s) 31
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 2 cut(s) 61, 349
HpyF10VI GCNNNNNNNGC 4 cut(s) 52, 71, 108, 138
HpyF3I CTNAG 1 cut(s) 273
Hsp92II CATG 2 cut(s) 61, 307
HspAI GCGC 2 cut(s) 55, 207
Kzo9I GATC 1 cut(s) 235
LmnI GCTCC 2 cut(s) 87, 159
Lsp1109I GCAGC 1 cut(s) 91
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MhlI GDGCHC 3 cut(s) 15, 143, 164
MluCI AATT 1 cut(s) 190
MmeI TCCRAC 1 cut(s) 137
MseI TTAA 1 cut(s) 222
MspA1I CMGCKG 1 cut(s) 151
MspI CCGG 2 cut(s) 27, 251
MspR9I CCNGG 3 cut(s) 27, 67, 252
MvaI CCWGG 1 cut(s) 67
MwoI GCNNNNNNNGC 4 cut(s) 52, 71, 108, 138
NciI CCSGG 2 cut(s) 27, 252
NcoI CCATGG 1 cut(s) 303
NdeII GATC 1 cut(s) 235
NlaIII CATG 2 cut(s) 61, 307
NlaIV GGNNCC 1 cut(s) 13
NmeAIII GCCGAG 1 cut(s) 162
NspI RCATGY 1 cut(s) 61
PaeI GCATGC 1 cut(s) 61
PaeR7I CTCGAG 1 cut(s) 163
PkrI GCNGC 3 cut(s) 8, 81, 150
PpuMI RGGWCCY 1 cut(s) 310
Psp124BI GAGCTC 2 cut(s) 143, 164
Psp5II RGGWCCY 1 cut(s) 310
Psp6I CCWGG 1 cut(s) 65
PspGI CCWGG 1 cut(s) 65
PspN4I GGNNCC 1 cut(s) 13
PspOMI GGGCCC 1 cut(s) 11
PspPI GGNCC 7 cut(s) 11, 12, 91, 134, 284, 300, 310
PspPPI RGGWCCY 1 cut(s) 310
PspXI VCTCGAGB 1 cut(s) 163
SacI GAGCTC 2 cut(s) 143, 164
SaqAI TTAA 1 cut(s) 222
SatI GCNGC 3 cut(s) 7, 80, 149
Sau3AI GATC 1 cut(s) 235
Sau96I GGNCC 7 cut(s) 11, 12, 91, 134, 284, 300, 310
ScrFI CCNGG 3 cut(s) 27, 67, 252
SduI GDGCHC 3 cut(s) 15, 143, 164
SetI ASST 9 cut(s) 23, 84, 143, 164, 222, 228, 294, 315, 329
Sfr274I CTCGAG 1 cut(s) 163
SinI GGWCC 2 cut(s) 300, 310
SlaI CTCGAG 1 cut(s) 163
SmlI CTYRAG 2 cut(s) 86, 163
SmoI CTYRAG 2 cut(s) 86, 163
SphI GCATGC 1 cut(s) 61
Sse9I AATT 1 cut(s) 190
SsiI CCGC 6 cut(s) 6, 9, 30, 94, 132, 149
SstI GAGCTC 2 cut(s) 143, 164
StyD4I CCNGG 3 cut(s) 25, 65, 250
StyI CCWWGG 2 cut(s) 303, 336
TaaI ACNGT 1 cut(s) 175
TaqI TCGA 2 cut(s) 164, 177
TasI AATT 1 cut(s) 190
TauI GCSGC 2 cut(s) 9, 151
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TscAI CASTG 1 cut(s) 53
TseI GCWGC 1 cut(s) 79
TspRI CASTG 1 cut(s) 53
VpaK11BI GGWCC 2 cut(s) 300, 310
XceI RCATGY 1 cut(s) 61
XhoI CTCGAG 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.