Rh7AG302300

Belongs to the eukaryotic ribosomal protein eS26 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
33247527 .. 33247706
180 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG302300.1

Sequence Viewer

Length: 180 bp
ATGCAGTACTGTGTGTCCTGTGCTATTCACTCTAACGTTGTGAGGGTGAGGTCTCGCACCAACAAGAGGAACCGTGAGCCACCACAGAGATTCATCAGACGCAGGGATGATGCCCAAAGGCCTGGAGCACCTGGTCAGGGAACCCGACCTGCTGGAGCTGGTGTTCCTGCTCGTACTTGA

Protein Analysis

59

Amino Acids

6.6

Weight (kDa)

11.86

Isoelectric Point (pI)

77.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S26e PF01283 1 - 36 6.3e-12 Ribosomal protein S26e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 157
AclI AACGTT 1 cut(s) 36
AfaI GTAC 2 cut(s) 8, 175
AfiI CCNNNNNNNGG 2 cut(s) 66, 137
AjnI CCWGG 2 cut(s) 121, 130
AloI GAACNNNNNNTCC 2 cut(s) 147, 179
AluBI AGCT 1 cut(s) 158
AluI AGCT 1 cut(s) 158
Alw21I GWGCWC 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 57
AoxI GGCC 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 58
Bbv12I GWGCWC 1 cut(s) 130
BciT130I CCWGG 2 cut(s) 123, 132
BcoDI GTCTC 1 cut(s) 57
BfuAI ACCTGC 1 cut(s) 157
BmcAI AGTACT 1 cut(s) 8
Bme1390I CCNGG 2 cut(s) 123, 132
BmiI GGNNCC 2 cut(s) 71, 142
BmrFI CCNGG 2 cut(s) 123, 132
BmsI GCATC 1 cut(s) 100
BpmI CTGGAG 2 cut(s) 144, 174
BsaI GGTCTC 1 cut(s) 57
BsaXI ACNNNNNCTCC 2 cut(s) 147, 177
Bsc4I CCNNNNNNNGG 2 cut(s) 66, 137
BseBI CCWGG 2 cut(s) 123, 132
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 2 cut(s) 66, 137
BshFI GGCC 1 cut(s) 121
BsiHKAI GWGCWC 1 cut(s) 130
BslI CCNNNNNNNGG 2 cut(s) 66, 137
BsmAI GTCTC 1 cut(s) 57
BsnI GGCC 1 cut(s) 121
Bso31I GGTCTC 1 cut(s) 57
Bsp1286I GDGCHC 1 cut(s) 130
BspANI GGCC 1 cut(s) 121
BspLI GGNNCC 2 cut(s) 71, 142
BspMI ACCTGC 1 cut(s) 157
BspTNI GGTCTC 1 cut(s) 57
Bst2UI CCWGG 2 cut(s) 123, 132
Bst4CI ACNGT 2 cut(s) 11, 74
BstF5I GGATG 1 cut(s) 112
BstMAI GTCTC 1 cut(s) 57
BstNI CCWGG 2 cut(s) 123, 132
BstSCI CCNGG 2 cut(s) 121, 130
BstXI CCANNNNNNTGG 1 cut(s) 122
BsuRI GGCC 1 cut(s) 121
BtsCI GGATG 1 cut(s) 112
BveI ACCTGC 1 cut(s) 157
CseI GACGC 1 cut(s) 108
CsiI ACCWGGT 1 cut(s) 130
Csp6I GTAC 2 cut(s) 7, 174
CviJI RGCY 3 cut(s) 79, 121, 158
CviKI_1 RGCY 3 cut(s) 79, 121, 158
CviQI GTAC 2 cut(s) 7, 174
Eco147I AGGCCT 1 cut(s) 121
Eco31I GGTCTC 1 cut(s) 57
EcoRII CCWGG 2 cut(s) 121, 130
FokI GGATG 1 cut(s) 119
GsuI CTGGAG 2 cut(s) 144, 174
HaeIII GGCC 1 cut(s) 121
HgaI GACGC 1 cut(s) 108
HinfI GANTC 1 cut(s) 90
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 11, 74
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 1 cut(s) 36
LmnI GCTCC 2 cut(s) 125, 155
LweI GCATC 1 cut(s) 100
MabI ACCWGGT 1 cut(s) 130
MaeII ACGT 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 130
MnlI CCTC 3 cut(s) 36, 42, 60
MspR9I CCNGG 2 cut(s) 123, 132
MvaI CCWGG 2 cut(s) 123, 132
NlaIV GGNNCC 2 cut(s) 71, 142
PceI AGGCCT 1 cut(s) 121
PfeI GAWTC 1 cut(s) 90
Psp1406I AACGTT 1 cut(s) 36
Psp6I CCWGG 2 cut(s) 121, 130
PspGI CCWGG 2 cut(s) 121, 130
PspN4I GGNNCC 2 cut(s) 71, 142
RsaI GTAC 2 cut(s) 8, 175
RsaNI GTAC 2 cut(s) 7, 174
ScaI AGTACT 1 cut(s) 8
ScrFI CCNGG 2 cut(s) 123, 132
SduI GDGCHC 1 cut(s) 130
SetI ASST 5 cut(s) 39, 53, 133, 151, 160
SexAI ACCWGGT 1 cut(s) 130
SfaNI GCATC 1 cut(s) 100
SseBI AGGCCT 1 cut(s) 121
StuI AGGCCT 1 cut(s) 121
StyD4I CCNGG 2 cut(s) 121, 130
TaaI ACNGT 2 cut(s) 11, 74
TaiI ACGT 1 cut(s) 39
TatI WGTACW 1 cut(s) 6
TfiI GAWTC 1 cut(s) 90
TspDTI ATGAA 1 cut(s) 82
ZrmI AGTACT 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.