Rh7CG321000

Belongs to the eukaryotic ribosomal protein eS26 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
34616504 .. 34617266
763 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG321000.1

Sequence Viewer

Length: 234 bp
ATGTGCAGGAGGCTTGTGTCTATGAGAGTTACACTGCCGAAGCTGTATTCTAAGATGCAGTACTGTGTGTCCTGTGCTATTCACTCTAACGTTGTGAGGGTGAGGTCTCGCACCAACAAGAGGAACCGTGAGCCACCACAGAGATTCATCAGACGCAGGGATGATGCCCAAAGGCCTGGAGCACCTGGTCAGGGAACCCGACCTGCTGGAGCTGGTGTTCCTGCTCGTACTTGA

Protein Analysis

77

Amino Acids

8.76

Weight (kDa)

11.83

Isoelectric Point (pI)

73.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S26e PF01283 6 - 54 1.5e-17 Ribosomal protein S26e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 211
AclI AACGTT 1 cut(s) 90
AfaI GTAC 2 cut(s) 62, 229
AfiI CCNNNNNNNGG 2 cut(s) 120, 191
AjnI CCWGG 2 cut(s) 175, 184
AloI GAACNNNNNNTCC 2 cut(s) 201, 233
AluBI AGCT 2 cut(s) 43, 212
AluI AGCT 2 cut(s) 43, 212
Alw21I GWGCWC 1 cut(s) 184
Alw26I GTCTC 1 cut(s) 111
AoxI GGCC 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 112
Bbv12I GWGCWC 1 cut(s) 184
BciT130I CCWGG 2 cut(s) 177, 186
BcoDI GTCTC 1 cut(s) 111
BfuAI ACCTGC 1 cut(s) 211
BmcAI AGTACT 1 cut(s) 62
Bme1390I CCNGG 2 cut(s) 177, 186
BmiI GGNNCC 2 cut(s) 125, 196
BmrFI CCNGG 2 cut(s) 177, 186
BmsI GCATC 2 cut(s) 45, 154
BpmI CTGGAG 2 cut(s) 198, 228
BsaI GGTCTC 1 cut(s) 111
BsaXI ACNNNNNCTCC 2 cut(s) 201, 231
Bsc4I CCNNNNNNNGG 2 cut(s) 120, 191
BseBI CCWGG 2 cut(s) 177, 186
BseGI GGATG 1 cut(s) 166
BseLI CCNNNNNNNGG 2 cut(s) 120, 191
BsgI GTGCAG 1 cut(s) 25
BshFI GGCC 1 cut(s) 175
BsiHKAI GWGCWC 1 cut(s) 184
BslI CCNNNNNNNGG 2 cut(s) 120, 191
BsmAI GTCTC 1 cut(s) 111
BsnI GGCC 1 cut(s) 175
Bso31I GGTCTC 1 cut(s) 111
Bsp1286I GDGCHC 1 cut(s) 184
BspANI GGCC 1 cut(s) 175
BspLI GGNNCC 2 cut(s) 125, 196
BspMI ACCTGC 1 cut(s) 211
BspTNI GGTCTC 1 cut(s) 111
Bst2UI CCWGG 2 cut(s) 177, 186
Bst4CI ACNGT 2 cut(s) 65, 128
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 1 cut(s) 166
BstMAI GTCTC 1 cut(s) 111
BstNI CCWGG 2 cut(s) 177, 186
BstSCI CCNGG 2 cut(s) 175, 184
BstXI CCANNNNNNTGG 1 cut(s) 176
BsuRI GGCC 1 cut(s) 175
BtsCI GGATG 1 cut(s) 166
BtsI GCAGTG 1 cut(s) 32
BtsIMutI CAGTG 1 cut(s) 32
BveI ACCTGC 1 cut(s) 211
CseI GACGC 1 cut(s) 162
CsiI ACCWGGT 1 cut(s) 184
Csp6I GTAC 2 cut(s) 61, 228
CviJI RGCY 5 cut(s) 13, 43, 133, 175, 212
CviKI_1 RGCY 5 cut(s) 13, 43, 133, 175, 212
CviQI GTAC 2 cut(s) 61, 228
DdeI CTNAG 1 cut(s) 51
Eco147I AGGCCT 1 cut(s) 175
Eco31I GGTCTC 1 cut(s) 111
EcoRII CCWGG 2 cut(s) 175, 184
FaiI YATR 1 cut(s) 23
FokI GGATG 1 cut(s) 173
GsuI CTGGAG 2 cut(s) 198, 228
HaeIII GGCC 1 cut(s) 175
HgaI GACGC 1 cut(s) 162
HinfI GANTC 1 cut(s) 144
HphI GGTGA 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 152
HpyCH4III ACNGT 2 cut(s) 65, 128
HpyCH4IV ACGT 1 cut(s) 90
HpyCH4V TGCA 2 cut(s) 6, 58
HpyF3I CTNAG 1 cut(s) 51
HpySE526I ACGT 1 cut(s) 90
LmnI GCTCC 2 cut(s) 179, 209
LweI GCATC 2 cut(s) 45, 154
MabI ACCWGGT 1 cut(s) 184
MaeII ACGT 1 cut(s) 90
MaeIII GTNAC 1 cut(s) 28
MhlI GDGCHC 1 cut(s) 184
MnlI CCTC 4 cut(s) 3, 90, 96, 114
MspR9I CCNGG 2 cut(s) 177, 186
MvaI CCWGG 2 cut(s) 177, 186
NlaIV GGNNCC 2 cut(s) 125, 196
PceI AGGCCT 1 cut(s) 175
PfeI GAWTC 1 cut(s) 144
Psp1406I AACGTT 1 cut(s) 90
Psp6I CCWGG 2 cut(s) 175, 184
PspGI CCWGG 2 cut(s) 175, 184
PspN4I GGNNCC 2 cut(s) 125, 196
RsaI GTAC 2 cut(s) 62, 229
RsaNI GTAC 2 cut(s) 61, 228
ScaI AGTACT 1 cut(s) 62
ScrFI CCNGG 2 cut(s) 177, 186
SduI GDGCHC 1 cut(s) 184
SetI ASST 6 cut(s) 45, 93, 107, 187, 205, 214
SexAI ACCWGGT 1 cut(s) 184
SfaNI GCATC 2 cut(s) 45, 154
SseBI AGGCCT 1 cut(s) 175
StuI AGGCCT 1 cut(s) 175
StyD4I CCNGG 2 cut(s) 175, 184
TaaI ACNGT 2 cut(s) 65, 128
TaiI ACGT 1 cut(s) 93
TatI WGTACW 1 cut(s) 60
TfiI GAWTC 1 cut(s) 144
TscAI CASTG 1 cut(s) 39
TspDTI ATGAA 1 cut(s) 136
TspRI CASTG 1 cut(s) 39
ZrmI AGTACT 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.