Rw7G017720

60s ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
18770697 .. 18770976
280 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G017720.1

Sequence Viewer

Length: 195 bp
ATGGCGATGGTTCCAGGGCAACTGATATGGGAGATAGTGAAGAAGAACAACTCTTTTCTGGTGAAGGAGTTCGGCAGAAGCCACGCTGGCATTAGGTTCAGCAAGGAGCCCAGCAACCTCTTGAATCTCCACTCCTACAAGCAATCCGGGTTGGCAAACAAGAAAACTGTGACAATTCAGCTCGGTAAGGACTAA

Protein Analysis

64

Amino Acids

7.2

Weight (kDa)

10.09

Isoelectric Point (pI)

38.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L28e PF01778 8 - 60 1.5e-18 Ribosomal L28e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 124
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
Asp700I GAANNNNTTC 1 cut(s) 68
AsuC2I CCSGG 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 73
BanII GRGCYC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 15
BcnI CCSGG 1 cut(s) 148
BglI GCCNNNNNGGC 1 cut(s) 87
Bme1390I CCNGG 2 cut(s) 15, 148
BmiI GGNNCC 2 cut(s) 12, 108
BmrFI CCNGG 2 cut(s) 15, 148
BpuMI CCSGG 1 cut(s) 148
BsaJI CCNNGG 1 cut(s) 14
BseBI CCWGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 14
BseYI CCCAGC 1 cut(s) 110
BsiSI CCGG 1 cut(s) 147
Bsp1286I GDGCHC 1 cut(s) 111
BspLI GGNNCC 2 cut(s) 12, 108
BssECI CCNNGG 1 cut(s) 14
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 88
BstMWI GCNNNNNNNGC 1 cut(s) 87
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 2 cut(s) 13, 146
BtgZI GCGATG 1 cut(s) 20
Cac8I GCNNGC 1 cut(s) 88
CviJI RGCY 3 cut(s) 81, 109, 181
CviKI_1 RGCY 3 cut(s) 81, 109, 181
Eco24I GRGCYC 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 13
EcoT38I GRGCYC 1 cut(s) 111
FaiI YATR 1 cut(s) 28
FriOI GRGCYC 1 cut(s) 111
GsaI CCCAGC 1 cut(s) 114
HapII CCGG 1 cut(s) 147
HinfI GANTC 1 cut(s) 124
HpaII CCGG 1 cut(s) 147
HphI GGTGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 87
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 5 cut(s) 27, 44, 72, 124, 160
MaeIII GTNAC 1 cut(s) 169
MboII GAAGA 2 cut(s) 52, 55
MhlI GDGCHC 1 cut(s) 111
MluCI AATT 1 cut(s) 174
MnlI CCTC 1 cut(s) 128
MroXI GAANNNNTTC 1 cut(s) 68
MspI CCGG 1 cut(s) 147
MspR9I CCNGG 2 cut(s) 15, 148
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 87
NciI CCSGG 1 cut(s) 148
NlaIV GGNNCC 2 cut(s) 12, 108
NmuCI GTSAC 1 cut(s) 169
PdmI GAANNNNTTC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 13
PspFI CCCAGC 1 cut(s) 110
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 2 cut(s) 12, 108
ScrFI CCNGG 2 cut(s) 15, 148
SduI GDGCHC 1 cut(s) 111
SetI ASST 3 cut(s) 98, 120, 183
Sse9I AATT 1 cut(s) 174
StyD4I CCNGG 2 cut(s) 13, 146
TaaI ACNGT 1 cut(s) 169
TasI AATT 1 cut(s) 174
TfiI GAWTC 1 cut(s) 124
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
XmnI GAANNNNTTC 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.