AT1G05340

Cysteine-rich and transmembrane domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0001954
Physical Location & Seq
Reverse (-)
1558778 .. 1559917
1140 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G05340.1

Sequence Viewer

Length: 219 bp
ATGAGCCAGTACGATCACAACCAGTCTGCAGGAGCTAACCCACCGCCACCGATGTCTACCTGTACATCACCACCACCGCCGATTGGTTACCCGACTAACCAACCGAGTCATGGTTCGGTAGCTCAGGGTAAAGTGGAAACCAAGTCTAAGGGTGACGGATTCTTCAAAGGCTGTCTTGCGGCCATGTGTTGCTGTTGTGCCCTGGACATTTGCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CYSTM

Protein Analysis

72

Amino Acids

7.48

Weight (kDa)

6.67

Isoelectric Point (pI)

56.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CYSTM PF12734 29 - 72 8.3e-14 Cysteine-rich TM module stress tolerance
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 56
AciI CCGC 3 cut(s) 44, 77, 179
AcoI YGGCCR 1 cut(s) 180
AfaI GTAC 2 cut(s) 11, 64
AfiI CCNNNNNNNGG 2 cut(s) 83, 110
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 1 cut(s) 201
AluBI AGCT 2 cut(s) 35, 122
AluI AGCT 2 cut(s) 35, 122
AoxI GGCC 1 cut(s) 180
AsuHPI GGTGA 2 cut(s) 60, 164
BaeGI GKGCMC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 203
BfmI CTRYAG 1 cut(s) 27
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 203
BmrFI CCNGG 1 cut(s) 203
Bpu10I CCTNAGC 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 201
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 110
Bse1I ACTGG 2 cut(s) 7, 22
BseBI CCWGG 1 cut(s) 203
BseDI CCNNGG 1 cut(s) 201
BseLI CCNNNNNNNGG 2 cut(s) 83, 110
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 2 cut(s) 7, 22
BseSI GKGCMC 1 cut(s) 202
BshFI GGCC 1 cut(s) 182
BslI CCNNNNNNNGG 2 cut(s) 83, 110
BsnI GGCC 1 cut(s) 182
Bsp1286I GDGCHC 1 cut(s) 202
Bsp1407I TGTACA 1 cut(s) 62
Bsp143I GATC 1 cut(s) 13
BspACI CCGC 3 cut(s) 44, 77, 179
BspANI GGCC 1 cut(s) 182
BspCNI CTCAG 1 cut(s) 136
BspMAI CTGCAG 1 cut(s) 31
BsrGI TGTACA 1 cut(s) 62
BsrI ACTGG 2 cut(s) 7, 22
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 203
BstAUI TGTACA 1 cut(s) 62
BstDEI CTNAG 2 cut(s) 123, 147
BstEII GGTNACC 1 cut(s) 86
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstNI CCWGG 1 cut(s) 203
BstPI GGTNACC 1 cut(s) 86
BstSCI CCNGG 1 cut(s) 201
BstSFI CTRYAG 1 cut(s) 27
BstSLI GKGCMC 1 cut(s) 202
BsuRI GGCC 1 cut(s) 182
Csp6I GTAC 2 cut(s) 10, 63
CviAII CATG 2 cut(s) 110, 184
CviJI RGCY 5 cut(s) 6, 35, 122, 171, 182
CviKI_1 RGCY 5 cut(s) 6, 35, 122, 171, 182
CviQI GTAC 2 cut(s) 10, 63
DdeI CTNAG 2 cut(s) 123, 147
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
EaeI YGGCCR 1 cut(s) 180
Eco91I GGTNACC 1 cut(s) 86
EcoO65I GGTNACC 1 cut(s) 86
EcoRII CCWGG 1 cut(s) 201
FaeI CATG 2 cut(s) 113, 187
FaiI YATR 2 cut(s) 111, 185
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FatI CATG 2 cut(s) 109, 183
FblI GTMKAC 1 cut(s) 56
Fnu4HI GCNGC 1 cut(s) 180
Fsp4HI GCNGC 1 cut(s) 180
GluI GCNGC 1 cut(s) 180
HaeIII GGCC 1 cut(s) 182
Hin1II CATG 2 cut(s) 113, 187
HinfI GANTC 2 cut(s) 106, 159
HphI GGTGA 2 cut(s) 60, 164
Hpy166II GTNNAC 1 cut(s) 57
Hpy8I GTNNAC 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 2 cut(s) 123, 147
Hsp92II CATG 2 cut(s) 113, 187
Kzo9I GATC 1 cut(s) 13
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 7 cut(s) 15, 20, 35, 73, 110, 188, 215
MaeIII GTNAC 2 cut(s) 86, 152
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 1 cut(s) 154
MhlI GDGCHC 1 cut(s) 202
MlyI GAGTC 1 cut(s) 115
MspR9I CCNGG 1 cut(s) 203
MvaI CCWGG 1 cut(s) 203
NdeII GATC 1 cut(s) 13
NlaIII CATG 2 cut(s) 113, 187
NmuCI GTSAC 1 cut(s) 152
PfeI GAWTC 1 cut(s) 159
PkrI GCNGC 1 cut(s) 181
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 201
PspEI GGTNACC 1 cut(s) 86
PspGI CCWGG 1 cut(s) 201
PstI CTGCAG 1 cut(s) 31
RsaI GTAC 2 cut(s) 11, 64
RsaNI GTAC 2 cut(s) 10, 63
SatI GCNGC 1 cut(s) 180
Sau3AI GATC 1 cut(s) 13
SchI GAGTC 1 cut(s) 115
ScrFI CCNGG 1 cut(s) 203
SduI GDGCHC 1 cut(s) 202
SetI ASST 3 cut(s) 37, 62, 124
SfcI CTRYAG 1 cut(s) 27
SsiI CCGC 3 cut(s) 44, 77, 179
StyD4I CCNGG 1 cut(s) 201
TatI WGTACW 1 cut(s) 62
TauI GCSGC 1 cut(s) 182
TfiI GAWTC 1 cut(s) 159
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
TspGWI ACGGA 1 cut(s) 171
XcmI CCANNNNNNNNNTGG 1 cut(s) 107
XmiI GTMKAC 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.