Rroxscaffold_2G00130230

Cysteine-rich TM module stress tolerance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001954
Physical Location & Seq
Reverse (-)
66361461 .. 66362505
1045 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00130230.1

Sequence Viewer

Length: 207 bp
ATGAGTTCAAGCACAACTAGTTCTGCAGCAGCATACCCGAAGCCACCTTATTCGGCTCCACCACCTGCTGGTTATCCAACAAGATCTGATGCCGGTGGCCAAAACGGTGGTCCTGTTCCGGTAGAGACCAAGTCGAAGGGTGATGGGTTCTGGAAGGGATGCTGTGCTGCTTTGTGTTGCTGTTGTATGTTGGATGCTTGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CYSTM

Protein Analysis

68

Amino Acids

6.85

Weight (kDa)

7.51

Isoelectric Point (pI)

65.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CYSTM PF12734 24 - 68 2.3e-12 Cysteine-rich TM module stress tolerance
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 73
Acc36I ACCTGC 1 cut(s) 73
AccB7I CCANNNNNTGG 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 1 cut(s) 9
AhlI ACTAGT 1 cut(s) 17
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 97
ApeKI GCWGC 3 cut(s) 26, 29, 167
ArsI GACNNNNNNTTYG 2 cut(s) 94, 126
AspS9I GGNCC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 152
AvaII GGWCC 1 cut(s) 110
BalI TGGCCA 1 cut(s) 99
BbvI GCAGC 3 cut(s) 38, 41, 154
BccI CCATC 1 cut(s) 137
BcoDI GTCTC 1 cut(s) 119
BcuI ACTAGT 1 cut(s) 17
BfaI CTAG 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 24
BfuAI ACCTGC 1 cut(s) 73
BglII AGATCT 1 cut(s) 83
BisI GCNGC 3 cut(s) 27, 30, 168
BlsI GCNGC 3 cut(s) 28, 31, 169
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 57
BmsI GCATC 3 cut(s) 79, 149, 184
BsaI GGTCTC 1 cut(s) 119
BsaWI WCCGGW 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse118I RCCGGY 1 cut(s) 92
BseGI GGATG 2 cut(s) 164, 199
BseLI CCNNNNNNNGG 1 cut(s) 68
BseXI GCAGC 3 cut(s) 38, 41, 154
BshFI GGCC 1 cut(s) 99
BsiSI CCGG 2 cut(s) 93, 119
BslI CCNNNNNNNGG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 99
Bso31I GGTCTC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 83
BspANI GGCC 1 cut(s) 99
BspLI GGNNCC 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 28
BspMI ACCTGC 1 cut(s) 73
BspTNI GGTCTC 1 cut(s) 119
BsrFI RCCGGY 1 cut(s) 92
BssAI RCCGGY 1 cut(s) 92
BssMI GATC 1 cut(s) 83
Bst4CI ACNGT 1 cut(s) 107
BstF5I GGATG 2 cut(s) 164, 199
BstKTI GATC 1 cut(s) 86
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 24
BstV1I GCAGC 3 cut(s) 38, 41, 154
BstX2I RGATCY 1 cut(s) 83
BstXI CCANNNNNNTGG 1 cut(s) 107
BstYI RGATCY 1 cut(s) 83
BsuRI GGCC 1 cut(s) 99
BtsCI GGATG 2 cut(s) 164, 199
BveI ACCTGC 1 cut(s) 73
Cfr10I RCCGGY 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 110
CviJI RGCY 3 cut(s) 43, 56, 99
CviKI_1 RGCY 3 cut(s) 43, 56, 99
DpnI GATC 1 cut(s) 85
DpnII GATC 1 cut(s) 83
EaeI YGGCCR 1 cut(s) 97
Eco31I GGTCTC 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 110
FaiI YATR 2 cut(s) 34, 188
Fnu4HI GCNGC 3 cut(s) 27, 30, 168
FokI GGATG 1 cut(s) 171
Fsp4HI GCNGC 3 cut(s) 27, 30, 168
FspBI CTAG 1 cut(s) 18
GluI GCNGC 3 cut(s) 27, 30, 168
HaeIII GGCC 1 cut(s) 99
HapII CCGG 2 cut(s) 93, 119
HpaII CCGG 2 cut(s) 93, 119
HphI GGTGA 1 cut(s) 152
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 151
HpyAV CCTTC 2 cut(s) 130, 148
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 26
Kzo9I GATC 1 cut(s) 83
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 6 cut(s) 54, 78, 106, 126, 132, 136
Lsp1109I GCAGC 3 cut(s) 38, 41, 154
LweI GCATC 3 cut(s) 79, 149, 184
MaeI CTAG 1 cut(s) 18
MalI GATC 1 cut(s) 85
MboI GATC 1 cut(s) 83
MflI RGATCY 1 cut(s) 83
MlsI TGGCCA 1 cut(s) 99
MluNI TGGCCA 1 cut(s) 99
MmeI TCCRAC 2 cut(s) 101, 171
Mox20I TGGCCA 1 cut(s) 99
MscI TGGCCA 1 cut(s) 99
Msp20I TGGCCA 1 cut(s) 99
MspI CCGG 2 cut(s) 93, 119
NdeII GATC 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 57
PaqCI CACCTGC 1 cut(s) 73
PflFI GACNNNGTC 1 cut(s) 130
PflMI CCANNNNNTGG 1 cut(s) 68
PkrI GCNGC 3 cut(s) 28, 31, 169
PspN4I GGNNCC 1 cut(s) 57
PspPI GGNCC 1 cut(s) 110
PstI CTGCAG 1 cut(s) 28
PsuI RGATCY 1 cut(s) 83
PsyI GACNNNGTC 1 cut(s) 130
SatI GCNGC 3 cut(s) 27, 30, 168
Sau3AI GATC 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 110
SetI ASST 2 cut(s) 49, 67
SfaNI GCATC 3 cut(s) 79, 149, 184
SfcI CTRYAG 1 cut(s) 24
SinI GGWCC 1 cut(s) 110
SpeI ACTAGT 1 cut(s) 17
SspMI CTAG 1 cut(s) 18
TaaI ACNGT 1 cut(s) 107
TaqI TCGA 1 cut(s) 134
TseI GCWGC 3 cut(s) 26, 29, 167
Tth111I GACNNNGTC 1 cut(s) 130
Van91I CCANNNNNTGG 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 110
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.