Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp06

Orthogroup ID

OG0001954

Physical Location & Seq

Genomic Coordinates Forward (+)

19399952 .. 19400435

Gene Structure 484 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.6G185200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

ATGAGTTCGTCGACTAATTCCGCAGCAGCATACCCTCCTCATCCCCAACCTTACTCGATGGCGCCTGGATCTTATTACGTGCAGGCTCCGCCACCTGCTGGTTATCCCACAAGAGATGCTCCAAATCCTGCTTCCGCTCATCATGGGCCTGTAGAAACCAAGTCCAAGGGTGATGGCTTCTGGAAGGGATGTTGTGCTGCCTTGTGTTGTTGTTGTCTCTTGGATGCTTGTTTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CYSTM

Protein Analysis

79

Amino Acids

8.11

Weight (kDa)

6.78

Isoelectric Point (pI)

53.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001954)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05340 AT2G32190 AT2G32190 AT2G32200 AT2G32200 AT2G32210 AT2G32210 AT2G32210 AT3G22231 AT3G22235 AT3G22235 AT3G22240
fragaria_vesca	FvH4_1g21001 FvH4_6g39683
malus_domestica	MD01G1028400.v1.1 MD09G1137600.v1.1 MD17G1127900.v1.1
prunus_persica	Prupe.3G187200_v2.0.a1 Prupe.3G187300_v2.0.a1 Prupe.3G187300_v2.0.a1 Prupe.6G185000_v2.0.a1 Prupe.6G185100_v2.0.a1 Prupe.6G185200_v2.0.a1 Prupe.6G185300_v2.0.a1 Prupe.6G185400_v2.0.a1 Prupe.6G185500_v2.0.a1 Prupe.6G185600_v2.0.a1
pyrus_communis	pycom09g05870 pycom17g12030
rosa_chinensis	RchiOBHm_Chr2g0114501 RchiOBHm_Chr2g0114521 RchiOBHm_Chr2g0153711 RchiOBHm_Chr2g0153751
rosa_laevigata	RLG00000020722
rosa_multiflora	Rmu_sc0015718.1_g000007
rosa_roxburghii	Rroxscaffold_2G00130230 Rroxscaffold_2G00130260
rosa_rugosa	Rorug02G0441600
rosa_samantha	Rh2AG248300 Rh2AG505100 Rh2BG257900 Rh2CG251600 Rh2DG256300
rosa_wichuraiana	Rw2G019300 Rw7G035710

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	103
Acc36I	ACCTGC	1 cut(s)	103
AccB1I	GGYRCC	1 cut(s)	61
AccB7I	CCANNNNNTGG	1 cut(s)	98
AccBSI	CCGCTC	1 cut(s)	137
AccI	GTMKAC	1 cut(s)	11
AciI	CCGC	3 cut(s)	21, 89, 135
AclWI	GGATC	1 cut(s)	76
AcyI	GRCGYC	1 cut(s)	62
AfiI	CCNNNNNNNGG	1 cut(s)	98
AjnI	CCWGG	1 cut(s)	64
AjuI	GAANNNNNNNTTGG	2 cut(s)	115, 147
Alw26I	GTCTC	1 cut(s)	221
AlwI	GGATC	1 cut(s)	76
AoxI	GGCC	1 cut(s)	146
ApeKI	GCWGC	3 cut(s)	23, 26, 197
AspLEI	GCGC	1 cut(s)	64
AspS9I	GGNCC	1 cut(s)	146
AsuHPI	GGTGA	1 cut(s)	182
BanI	GGYRCC	1 cut(s)	61
BbvI	GCAGC	3 cut(s)	35, 38, 184
BccI	CCATC	2 cut(s)	52, 167
BciT130I	CCWGG	1 cut(s)	66
BcoDI	GTCTC	1 cut(s)	221
BfmI	CTRYAG	1 cut(s)	150
BfoI	RGCGCY	1 cut(s)	65
BfuAI	ACCTGC	1 cut(s)	103
BisI	GCNGC	3 cut(s)	24, 27, 198
BlsI	GCNGC	3 cut(s)	25, 28, 199
Bme1390I	CCNGG	1 cut(s)	66
BmgT120I	GGNCC	1 cut(s)	146
BmiI	GGNNCC	2 cut(s)	63, 87
BmrFI	CCNGG	1 cut(s)	66
BmsI	GCATC	2 cut(s)	106, 214
BsaAI	YACGTR	1 cut(s)	79
BsaHI	GRCGYC	1 cut(s)	62
BsaJI	CCNNGG	1 cut(s)	165
Bsc4I	CCNNNNNNNGG	1 cut(s)	98
BseBI	CCWGG	1 cut(s)	66
BseDI	CCNNGG	1 cut(s)	165
BseGI	GGATG	3 cut(s)	40, 194, 229
BseLI	CCNNNNNNNGG	1 cut(s)	98
BseRI	GAGGAG	1 cut(s)	27
BseXI	GCAGC	3 cut(s)	35, 38, 184
BsgI	GTGCAG	1 cut(s)	101
BshFI	GGCC	1 cut(s)	148
BshNI	GGYRCC	1 cut(s)	61
BslI	CCNNNNNNNGG	1 cut(s)	98
BsmAI	GTCTC	1 cut(s)	221
BsnI	GGCC	1 cut(s)	148
Bsp143I	GATC	1 cut(s)	68
BspACI	CCGC	3 cut(s)	21, 89, 135
BspANI	GGCC	1 cut(s)	148
BspLI	GGNNCC	2 cut(s)	63, 87
BspMI	ACCTGC	1 cut(s)	103
BspPI	GGATC	1 cut(s)	76
BspT107I	GGYRCC	1 cut(s)	61
BsrBI	CCGCTC	1 cut(s)	137
BssECI	CCNNGG	1 cut(s)	165
BssMI	GATC	1 cut(s)	68
BssNI	GRCGYC	1 cut(s)	62
BssT1I	CCWWGG	1 cut(s)	165
Bst2UI	CCWGG	1 cut(s)	66
BstACI	GRCGYC	1 cut(s)	62
BstBAI	YACGTR	1 cut(s)	79
BstC8I	GCNNGC	1 cut(s)	84
BstF5I	GGATG	3 cut(s)	40, 194, 229
BstH2I	RGCGCY	1 cut(s)	65
BstHHI	GCGC	1 cut(s)	64
BstKTI	GATC	1 cut(s)	71
BstMAI	GTCTC	1 cut(s)	221
BstMBI	GATC	1 cut(s)	68
BstMWI	GCNNNNNNNGC	1 cut(s)	88
BstNI	CCWGG	1 cut(s)	66
BstSCI	CCNGG	1 cut(s)	64
BstSFI	CTRYAG	1 cut(s)	150
BstV1I	GCAGC	3 cut(s)	35, 38, 184
BstX2I	RGATCY	1 cut(s)	68
BstYI	RGATCY	1 cut(s)	68
BsuRI	GGCC	1 cut(s)	148
BtsCI	GGATG	3 cut(s)	40, 194, 229
BveI	ACCTGC	1 cut(s)	103
Cac8I	GCNNGC	1 cut(s)	84
CfoI	GCGC	1 cut(s)	64
Cfr13I	GGNCC	1 cut(s)	146
CviAII	CATG	1 cut(s)	143
CviJI	RGCY	3 cut(s)	86, 148, 177
CviKI_1	RGCY	3 cut(s)	86, 148, 177
DinI	GGCGCC	1 cut(s)	63
DpnI	GATC	1 cut(s)	70
DpnII	GATC	1 cut(s)	68
EciI	GGCGGA	1 cut(s)	78
Eco130I	CCWWGG	1 cut(s)	165
EcoRII	CCWGG	1 cut(s)	64
EcoT14I	CCWWGG	1 cut(s)	165
EgeI	GGCGCC	1 cut(s)	63
EheI	GGCGCC	1 cut(s)	63
ErhI	CCWWGG	1 cut(s)	165
FaeI	CATG	1 cut(s)	146
FaiI	YATR	2 cut(s)	31, 144
FatI	CATG	1 cut(s)	142
FblI	GTMKAC	1 cut(s)	11
Fnu4HI	GCNGC	3 cut(s)	24, 27, 198
FokI	GGATG	2 cut(s)	27, 201
Fsp4HI	GCNGC	3 cut(s)	24, 27, 198
GlaI	GCGC	1 cut(s)	63
GluI	GCNGC	3 cut(s)	24, 27, 198
HaeII	RGCGCY	1 cut(s)	65
HaeIII	GGCC	1 cut(s)	148
HhaI	GCGC	1 cut(s)	64
Hin1I	GRCGYC	1 cut(s)	62
Hin1II	CATG	1 cut(s)	146
Hin6I	GCGC	1 cut(s)	62
HinP1I	GCGC	1 cut(s)	62
HincII	GTYRAC	1 cut(s)	12
HindII	GTYRAC	1 cut(s)	12
HphI	GGTGA	1 cut(s)	182
Hpy166II	GTNNAC	1 cut(s)	12
Hpy188III	TCNNGA	1 cut(s)	181
Hpy8I	GTNNAC	1 cut(s)	12
Hpy99I	CGWCG	1 cut(s)	13
HpyAV	CCTTC	1 cut(s)	178
HpyCH4IV	ACGT	1 cut(s)	78
HpyCH4V	TGCA	1 cut(s)	82
HpyF10VI	GCNNNNNNNGC	1 cut(s)	88
HpySE526I	ACGT	1 cut(s)	78
Hsp92I	GRCGYC	1 cut(s)	62
Hsp92II	CATG	1 cut(s)	146
HspAI	GCGC	1 cut(s)	62
KasI	GGCGCC	1 cut(s)	61
Kzo9I	GATC	1 cut(s)	68
LmnI	GCTCC	2 cut(s)	91, 124
LpnPI	CCDG	8 cut(s)	51, 68, 78, 84, 108, 141, 162, 166
Lsp1109I	GCAGC	3 cut(s)	35, 38, 184
LweI	GCATC	2 cut(s)	106, 214
MaeII	ACGT	1 cut(s)	78
MalI	GATC	1 cut(s)	70
MbiI	CCGCTC	1 cut(s)	137
MboI	GATC	1 cut(s)	68
MflI	RGATCY	1 cut(s)	68
MluCI	AATT	1 cut(s)	16
Mly113I	GGCGCC	1 cut(s)	62
MnlI	CCTC	2 cut(s)	45, 48
MspR9I	CCNGG	1 cut(s)	66
MvaI	CCWGG	1 cut(s)	66
MwoI	GCNNNNNNNGC	1 cut(s)	88
NarI	GGCGCC	1 cut(s)	62
NdeII	GATC	1 cut(s)	68
NlaIII	CATG	1 cut(s)	146
NlaIV	GGNNCC	2 cut(s)	63, 87
PaqCI	CACCTGC	1 cut(s)	103
PflMI	CCANNNNNTGG	1 cut(s)	98
PkrI	GCNGC	3 cut(s)	25, 28, 199
PluTI	GGCGCC	1 cut(s)	65
Ppu21I	YACGTR	1 cut(s)	79
Psp6I	CCWGG	1 cut(s)	64
PspGI	CCWGG	1 cut(s)	64
PspN4I	GGNNCC	2 cut(s)	63, 87
PspPI	GGNCC	1 cut(s)	146
PsuI	RGATCY	1 cut(s)	68
SalI	GTCGAC	1 cut(s)	10
SatI	GCNGC	3 cut(s)	24, 27, 198
Sau3AI	GATC	1 cut(s)	68
Sau96I	GGNCC	1 cut(s)	146
ScrFI	CCNGG	1 cut(s)	66
SetI	ASST	3 cut(s)	52, 81, 97
SfaNI	GCATC	2 cut(s)	106, 214
SfcI	CTRYAG	1 cut(s)	150
SfoI	GGCGCC	1 cut(s)	63
Sse9I	AATT	1 cut(s)	16
SsiI	CCGC	3 cut(s)	21, 89, 135
SspDI	GGCGCC	1 cut(s)	61
StyD4I	CCNGG	1 cut(s)	64
StyI	CCWWGG	1 cut(s)	165
TaiI	ACGT	1 cut(s)	81
TaqI	TCGA	2 cut(s)	11, 56
TasI	AATT	1 cut(s)	16
TseI	GCWGC	3 cut(s)	23, 26, 197
Van91I	CCANNNNNTGG	1 cut(s)	98
XmiI	GTMKAC	1 cut(s)	11

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.