AT3G27090

CONTAINS InterPro DOMAIN s Development and cell death domain (InterPro IPR013989), Kelch related (InterPro IPR013089)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0002574
Physical Location & Seq
Forward (+)
9989511 .. 9991903
2393 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G27090.1

Sequence Viewer

Length: 891 bp
ATGGACAGCTTCTGGCAATTAGGTGATGAGCTACGAGGTCAGACGAGAGCATCAGAGGATCACAAATGGTCTACTGTTGCAACGAAGCTAGCTGAGCAAACTAGAATGAAAGGGGAGAGGATGAACAATCTTGATCTCTCCAAAGGTTACACTGAGTTTAGACCAAGTGAGAAATTCAGTTTCCAGGAGAACAATCTTAACTTCAACATGTTGAATTTGGATGGTAAATTTGGTGAAAGCATCATGGGGAAGACTTCGATGCAGAGCAATGTTTATAATATGAATACTGTTTTCCAGAAGAATGACTTTAAGAGTGGAGGCAACATGAAAGTTAACAAGTATAATGGTAATGTTGTTGCTAACAAGGAGATGAGCAACAACAAACATAACAACAACTGCAATGATAATGGGAATATGAATTTGGCTGTTGACAAGAGGTTTAAAACCTTGCCTGCTTCGGAGACTCTTCCGAGGAATGAAGTTCTTGGTGGTTACATCTTTGTTTGCAACAATGATACTATGCAGGAGGATATGAAACGTCACCTCTTTGGTTTACCTCCAAGATACAGAGACTCTGTTCGAGCTATAACACCTGGATTGCCTCTGTTTCTTTACAACTACACCACTCACCAGCTTCATGGTATCTTTGAGGCAACAACTTTTGGAGGTACTAATATTGATGCTACTGCTTGGGAAGACAAAAAGTGCAAAGGAGAGTCAAGGTTTCCGGCTCAGGTAAGGATCAGAGTGAGGAAAATCTGCAAAGCCTTGGAAGAGGACTCCTTCAGGCCAGTACTTCACCACTATGATGGTCCAAAATTCCGCCTTGAGCTCTCTGTTCCTGAGACATTGGATCTGCTAGATCTTTGCGAACAAGCTGGTTCTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dev_Cell_Death

Protein Analysis

296

Amino Acids

33.84

Weight (kDa)

8.18

Isoelectric Point (pI)

34.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dev_Cell_Death PF10539 163 - 289 1.2e-38 Development and cell death domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 276
AccI GTMKAC 1 cut(s) 71
AciI CCGC 1 cut(s) 823
AclWI GGATC 3 cut(s) 66, 749, 861
AcsI RAATTY 5 cut(s) 173, 214, 227, 418, 818
AcuI CTGAAG 1 cut(s) 769
AfaI GTAC 2 cut(s) 670, 795
AflIII ACRYGT 1 cut(s) 207
AgsI TTSAA 2 cut(s) 205, 214
AjnI CCWGG 2 cut(s) 183, 592
AjuI GAANNNNNNNTTGG 2 cut(s) 404, 436
AluBI AGCT 8 cut(s) 9, 31, 88, 92, 584, 634, 832, 878
AluI AGCT 8 cut(s) 9, 31, 88, 92, 584, 634, 832, 878
Alw21I GWGCWC 1 cut(s) 834
Alw26I GTCTC 3 cut(s) 455, 564, 839
AlwI GGATC 3 cut(s) 66, 749, 861
AlwNI CAGNNNCTG 1 cut(s) 12
AoxI GGCC 1 cut(s) 788
ApoI RAATTY 5 cut(s) 173, 214, 227, 418, 818
AspS9I GGNCC 1 cut(s) 812
AsuHPI GGTGA 5 cut(s) 35, 245, 533, 620, 791
AsuNHI GCTAGC 1 cut(s) 88
AvaII GGWCC 1 cut(s) 812
BanII GRGCYC 1 cut(s) 834
BbsI GAAGAC 2 cut(s) 257, 702
Bbv12I GWGCWC 1 cut(s) 834
BccI CCATC 2 cut(s) 215, 803
BciT130I CCWGG 2 cut(s) 185, 594
BcoDI GTCTC 3 cut(s) 455, 564, 839
BfaI CTAG 3 cut(s) 89, 102, 860
BglII AGATCT 1 cut(s) 862
BlpI GCTNAGC 1 cut(s) 93
BmcAI AGTACT 1 cut(s) 795
Bme1390I CCNGG 2 cut(s) 185, 594
Bme18I GGWCC 1 cut(s) 812
BmgT120I GGNCC 1 cut(s) 812
BmrFI CCNGG 2 cut(s) 185, 594
BmsI GCATC 4 cut(s) 59, 249, 249, 670
BmtI GCTAGC 1 cut(s) 92
BpiI GAAGAC 2 cut(s) 257, 702
Bpu10I CCTNAGC 1 cut(s) 732
Bpu1102I GCTNAGC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 848
BsaJI CCNNGG 2 cut(s) 470, 768
Bse1I ACTGG 1 cut(s) 791
Bse3DI GCAATG 2 cut(s) 274, 406
BseBI CCWGG 2 cut(s) 185, 594
BseDI CCNNGG 2 cut(s) 470, 768
BseGI GGATG 2 cut(s) 126, 226
BseMI GCAATG 2 cut(s) 274, 406
BseMII CTCAG 4 cut(s) 84, 144, 746, 834
BseNI ACTGG 1 cut(s) 791
BshFI GGCC 1 cut(s) 790
BsiHKAI GWGCWC 1 cut(s) 834
BsiSI CCGG 1 cut(s) 728
BsmAI GTCTC 3 cut(s) 455, 564, 839
BsnI GGCC 1 cut(s) 790
Bsp1286I GDGCHC 1 cut(s) 834
Bsp143I GATC 5 cut(s) 58, 133, 741, 853, 862
Bsp1720I GCTNAGC 1 cut(s) 93
BspACI CCGC 1 cut(s) 823
BspANI GGCC 1 cut(s) 790
BspCNI CTCAG 4 cut(s) 85, 145, 745, 835
BspOI GCTAGC 1 cut(s) 92
BspPI GGATC 3 cut(s) 66, 749, 861
BsrDI GCAATG 2 cut(s) 274, 406
BsrI ACTGG 1 cut(s) 791
BssECI CCNNGG 2 cut(s) 470, 768
BssMI GATC 5 cut(s) 58, 133, 741, 853, 862
BssT1I CCWWGG 1 cut(s) 768
Bst2UI CCWGG 2 cut(s) 185, 594
Bst4CI ACNGT 2 cut(s) 76, 289
Bst6I CTCTTC 2 cut(s) 471, 768
BstC8I GCNNGC 2 cut(s) 90, 453
BstDEI CTNAG 4 cut(s) 93, 153, 732, 843
BstF5I GGATG 2 cut(s) 126, 226
BstKTI GATC 5 cut(s) 61, 136, 744, 856, 865
BstMAI GTCTC 3 cut(s) 455, 564, 839
BstMBI GATC 5 cut(s) 58, 133, 741, 853, 862
BstMWI GCNNNNNNNGC 2 cut(s) 94, 884
BstNI CCWGG 2 cut(s) 185, 594
BstNSI RCATGY 1 cut(s) 211
BstSCI CCNGG 2 cut(s) 183, 592
BstV2I GAAGAC 2 cut(s) 257, 702
BstX2I RGATCY 2 cut(s) 853, 862
BstXI CCANNNNNNTGG 2 cut(s) 638, 809
BstYI RGATCY 2 cut(s) 853, 862
BsuRI GGCC 1 cut(s) 790
BtsCI GGATG 2 cut(s) 126, 226
BtsIMutI CAGTG 1 cut(s) 150
Cac8I GCNNGC 2 cut(s) 90, 453
CaiI CAGNNNCTG 1 cut(s) 12
Cfr13I GGNCC 1 cut(s) 812
Csp6I GTAC 2 cut(s) 669, 794
CviAII CATG 4 cut(s) 208, 244, 325, 638
CviQI GTAC 2 cut(s) 669, 794
DdeI CTNAG 4 cut(s) 93, 153, 732, 843
DpnI GATC 5 cut(s) 60, 135, 743, 855, 864
DpnII GATC 5 cut(s) 58, 133, 741, 853, 862
DraI TTTAAA 1 cut(s) 442
Eam1104I CTCTTC 2 cut(s) 471, 768
EarI CTCTTC 2 cut(s) 471, 768
EciI GGCGGA 1 cut(s) 812
Ecl136II GAGCTC 1 cut(s) 832
Eco130I CCWWGG 1 cut(s) 768
Eco24I GRGCYC 1 cut(s) 834
Eco47I GGWCC 1 cut(s) 812
Eco53kI GAGCTC 1 cut(s) 832
Eco57I CTGAAG 1 cut(s) 769
EcoICRI GAGCTC 1 cut(s) 832
EcoRII CCWGG 2 cut(s) 183, 592
EcoT14I CCWWGG 1 cut(s) 768
EcoT38I GRGCYC 1 cut(s) 834
ErhI CCWWGG 1 cut(s) 768
FaeI CATG 4 cut(s) 211, 247, 328, 641
FalI AAGNNNNNCTT 2 cut(s) 290, 322
FatI CATG 4 cut(s) 207, 243, 324, 637
FblI GTMKAC 1 cut(s) 71
FokI GGATG 2 cut(s) 133, 233
FriOI GRGCYC 1 cut(s) 834
FspBI CTAG 3 cut(s) 89, 102, 860
HaeIII GGCC 1 cut(s) 790
HapII CCGG 1 cut(s) 728
Hin1II CATG 4 cut(s) 211, 247, 328, 641
HincII GTYRAC 2 cut(s) 334, 430
HindII GTYRAC 2 cut(s) 334, 430
HinfI GANTC 4 cut(s) 463, 572, 716, 779
HpaI GTTAAC 1 cut(s) 334
HpaII CCGG 1 cut(s) 728
HphI GGTGA 5 cut(s) 35, 245, 533, 620, 791
Hpy166II GTNNAC 4 cut(s) 72, 334, 430, 554
Hpy188I TCNGA 5 cut(s) 42, 55, 460, 471, 746
Hpy188III TCNNGA 3 cut(s) 131, 295, 842
Hpy8I GTNNAC 4 cut(s) 72, 334, 430, 554
HpyAV CCTTC 1 cut(s) 793
HpyCH4III ACNGT 2 cut(s) 76, 289
HpyCH4IV ACGT 1 cut(s) 538
HpyCH4V TGCA 8 cut(s) 80, 262, 399, 507, 523, 708, 762, 887
HpyF10VI GCNNNNNNNGC 2 cut(s) 94, 884
HpyF3I CTNAG 4 cut(s) 93, 153, 732, 843
HpySE526I ACGT 1 cut(s) 538
Hsp92II CATG 4 cut(s) 211, 247, 328, 641
KspAI GTTAAC 1 cut(s) 334
Kzo9I GATC 5 cut(s) 58, 133, 741, 853, 862
LweI GCATC 4 cut(s) 59, 249, 249, 670
MaeI CTAG 3 cut(s) 89, 102, 860
MaeII ACGT 1 cut(s) 538
MaeIII GTNAC 3 cut(s) 146, 491, 539
MalI GATC 5 cut(s) 60, 135, 743, 855, 864
MboI GATC 5 cut(s) 58, 133, 741, 853, 862
MboII GAAGA 5 cut(s) 262, 310, 458, 707, 785
MflI RGATCY 2 cut(s) 853, 862
MhlI GDGCHC 1 cut(s) 834
MluCI AATT 6 cut(s) 17, 173, 214, 227, 418, 818
MlyI GAGTC 4 cut(s) 457, 566, 725, 773
MseI TTAA 4 cut(s) 198, 309, 333, 441
MslI CAYNNNNRTG 2 cut(s) 804, 807
MspI CCGG 1 cut(s) 728
MspR9I CCNGG 2 cut(s) 185, 594
MvaI CCWGG 2 cut(s) 185, 594
MwoI GCNNNNNNNGC 2 cut(s) 94, 884
NdeII GATC 5 cut(s) 58, 133, 741, 853, 862
NheI GCTAGC 1 cut(s) 88
NlaIII CATG 4 cut(s) 211, 247, 328, 641
NmuCI GTSAC 1 cut(s) 539
NspI RCATGY 1 cut(s) 211
PciI ACATGT 1 cut(s) 207
PfoI TCCNGGA 1 cut(s) 183
PleI GAGTC 4 cut(s) 457, 566, 724, 773
PpsI GAGTC 4 cut(s) 457, 566, 724, 773
PscI ACATGT 1 cut(s) 207
PsiI TTATAA 1 cut(s) 276
Psp124BI GAGCTC 1 cut(s) 834
Psp6I CCWGG 2 cut(s) 183, 592
PspGI CCWGG 2 cut(s) 183, 592
PspPI GGNCC 1 cut(s) 812
PstNI CAGNNNCTG 1 cut(s) 12
PsuI RGATCY 2 cut(s) 853, 862
RsaI GTAC 2 cut(s) 670, 795
RsaNI GTAC 2 cut(s) 669, 794
RseI CAYNNNNRTG 2 cut(s) 804, 807
SacI GAGCTC 1 cut(s) 834
SaqAI TTAA 4 cut(s) 198, 309, 333, 441
Sau3AI GATC 5 cut(s) 58, 133, 741, 853, 862
Sau96I GGNCC 1 cut(s) 812
ScaI AGTACT 1 cut(s) 795
SchI GAGTC 4 cut(s) 457, 566, 725, 773
ScrFI CCNGG 2 cut(s) 185, 594
SduI GDGCHC 1 cut(s) 834
SfaNI GCATC 4 cut(s) 59, 249, 249, 670
SinI GGWCC 1 cut(s) 812
SmiMI CAYNNNNRTG 2 cut(s) 804, 807
SmlI CTYRAG 1 cut(s) 827
SmoI CTYRAG 1 cut(s) 827
Sse9I AATT 6 cut(s) 17, 173, 214, 227, 418, 818
SsiI CCGC 1 cut(s) 823
SspI AATATT 1 cut(s) 676
SspMI CTAG 3 cut(s) 89, 102, 860
SstI GAGCTC 1 cut(s) 834
StyD4I CCNGG 2 cut(s) 183, 592
StyI CCWWGG 1 cut(s) 768
TaaI ACNGT 2 cut(s) 76, 289
TaiI ACGT 1 cut(s) 541
TaqI TCGA 2 cut(s) 257, 580
TasI AATT 6 cut(s) 17, 173, 214, 227, 418, 818
TatI WGTACW 1 cut(s) 793
Tru1I TTAA 4 cut(s) 198, 309, 333, 441
Tru9I TTAA 4 cut(s) 198, 309, 333, 441
TscAI CASTG 1 cut(s) 157
TseFI GTSAC 1 cut(s) 539
Tsp45I GTSAC 1 cut(s) 539
TspDTI ATGAA 8 cut(s) 122, 137, 296, 341, 431, 492, 548, 626
TspRI CASTG 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 812
XapI RAATTY 5 cut(s) 173, 214, 227, 418, 818
XceI RCATGY 1 cut(s) 211
XmiI GTMKAC 1 cut(s) 71
XspI CTAG 3 cut(s) 89, 102, 860
ZrmI AGTACT 1 cut(s) 795
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.