Rh2CG639200

B2 protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0002574
Physical Location & Seq
Forward (+)
80999859 .. 81004067
4209 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG639200.1

Sequence Viewer

Length: 774 bp
ATGGAGAGCATCCATACCTATTGGCAGTTGGGTGATGAGCTTCGTGGACAGTCGAAAGTTGCAGAGGATCACAAATGGTTAATGGTTGCTTCCAAATTGGCTGAGCAAACAAGGTCAAAGGGCGAGCGCATGAATAACCTTGATCTTTCAAAGGGCCCAACTGAAACAAGAGCAAGGGACAAATTTGGGTTCCAGGAAGATAACAAATTTGAAAGCCTTAACTTTAACATGTTGAACTTGGACTCGAAAGTAAATGAAAATGTGAGCAAGAGTTCCTTTAGGAATGGGATTTACAACATGAATGCAGTGTACCAGAAAAACAGTGCAAGCTTTGTGGGGAACATGACTGGTAACAAGTACAATGGCAATCACCTCAGCAACAAGGAAACCAACAACAGCGGTAATAACAACAACAACAACAACGAAACTGGGAATGTTGTTGAGAAAAGGTTCAAGACCTTGCCTGCAACTGAGACACTTCCCCGAAATGAGGTGCTTGGAGGTTACATCTTTGTATGCAACAATGACACAATGCAGGAAGATTTGAAGCGACAACTATTCGGTTTACCTCCAAGGTACAGGGACTCTGTTCGGGCGATTACACCTGGCTTACCTCTGTTTCTCTACAACTATACAACCCACCAACTGCATGGCATTTTTGAGGCATCAAGCTTTGGCGGTTCAAACATTGATCCAACTGCTTGGGAAGACAAGAAATGTAAAGGCGAGTCAAGGTTTCCTGCGCAGGTAGTTACTAGATTTGGATTGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dev_Cell_Death

Protein Analysis

257

Amino Acids

29.17

Weight (kDa)

8.73

Isoelectric Point (pI)

29.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dev_Cell_Death PF10539 167 - 252 6.1e-29 Development and cell death domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 744
Acc36I ACCTGC 1 cut(s) 736
AciI CCGC 2 cut(s) 399, 678
AclWI GGATC 2 cut(s) 75, 686
AcsI RAATTY 2 cut(s) 182, 206
AfaI GTAC 3 cut(s) 311, 359, 578
AfiI CCNNNNNNNGG 1 cut(s) 490
AflIII ACRYGT 1 cut(s) 228
AgsI TTSAA 6 cut(s) 150, 212, 235, 454, 547, 684
AjnI CCWGG 2 cut(s) 192, 604
AluBI AGCT 3 cut(s) 40, 330, 672
AluI AGCT 3 cut(s) 40, 330, 672
Alw26I GTCTC 1 cut(s) 467
AlwI GGATC 2 cut(s) 75, 686
AoxI GGCC 1 cut(s) 154
ApaI GGGCCC 1 cut(s) 158
ApoI RAATTY 2 cut(s) 182, 206
Asp700I GAANNNNTTC 1 cut(s) 449
AspLEI GCGC 2 cut(s) 129, 745
AspS9I GGNCC 2 cut(s) 154, 155
AsuHPI GGTGA 2 cut(s) 44, 362
BaeGI GKGCMC 1 cut(s) 158
BanII GRGCYC 1 cut(s) 158
BbsI GAAGAC 1 cut(s) 714
BbvCI CCTCAGC 1 cut(s) 374
BciT130I CCWGG 2 cut(s) 194, 606
BcoDI GTCTC 1 cut(s) 467
BfaI CTAG 1 cut(s) 756
BfuAI ACCTGC 1 cut(s) 736
BlpI GCTNAGC 1 cut(s) 102
Bme1390I CCNGG 2 cut(s) 194, 606
BmgT120I GGNCC 2 cut(s) 154, 155
BmiI GGNNCC 2 cut(s) 156, 191
BmrFI CCNGG 2 cut(s) 194, 606
BmrI ACTGGG 1 cut(s) 438
BmsI GCATC 2 cut(s) 18, 674
BmuI ACTGGG 1 cut(s) 438
BpiI GAAGAC 1 cut(s) 714
Bpu10I CCTNAGC 1 cut(s) 374
Bpu1102I GCTNAGC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 572
Bsc4I CCNNNNNNNGG 1 cut(s) 490
Bse1I ACTGG 2 cut(s) 352, 433
BseBI CCWGG 2 cut(s) 194, 606
BseDI CCNNGG 1 cut(s) 572
BseGI GGATG 1 cut(s) 9
BseLI CCNNNNNNNGG 1 cut(s) 490
BseMII CTCAG 3 cut(s) 93, 388, 462
BseNI ACTGG 2 cut(s) 352, 433
BseSI GKGCMC 1 cut(s) 158
BshFI GGCC 1 cut(s) 156
BslFI GGGAC 2 cut(s) 191, 596
BslI CCNNNNNNNGG 1 cut(s) 490
BsmAI GTCTC 1 cut(s) 467
BsmFI GGGAC 2 cut(s) 191, 596
BsmI GAATGC 1 cut(s) 307
BsnI GGCC 1 cut(s) 156
Bsp120I GGGCCC 1 cut(s) 154
Bsp1286I GDGCHC 1 cut(s) 158
Bsp143I GATC 3 cut(s) 67, 142, 691
Bsp1720I GCTNAGC 1 cut(s) 102
BspACI CCGC 2 cut(s) 399, 678
BspANI GGCC 1 cut(s) 156
BspCNI CTCAG 3 cut(s) 94, 387, 463
BspLI GGNNCC 2 cut(s) 156, 191
BspMI ACCTGC 1 cut(s) 736
BspPI GGATC 2 cut(s) 75, 686
BsrI ACTGG 2 cut(s) 352, 433
BssECI CCNNGG 1 cut(s) 572
BssMI GATC 3 cut(s) 67, 142, 691
BssT1I CCWWGG 1 cut(s) 572
Bst2UI CCWGG 2 cut(s) 194, 606
Bst4CI ACNGT 2 cut(s) 51, 323
BstC8I GCNNGC 3 cut(s) 125, 328, 465
BstDEI CTNAG 3 cut(s) 102, 374, 471
BstF5I GGATG 1 cut(s) 9
BstHHI GCGC 2 cut(s) 129, 745
BstKTI GATC 3 cut(s) 70, 145, 694
BstMAI GTCTC 1 cut(s) 467
BstMBI GATC 3 cut(s) 67, 142, 691
BstNI CCWGG 2 cut(s) 194, 606
BstNSI RCATGY 1 cut(s) 232
BstSCI CCNGG 2 cut(s) 192, 604
BstSLI GKGCMC 1 cut(s) 158
BstV2I GAAGAC 1 cut(s) 714
BstXI CCANNNNNNTGG 2 cut(s) 650, 702
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 1 cut(s) 9
BtsI GCAGTG 1 cut(s) 312
BtsIMutI CAGTG 2 cut(s) 312, 328
BveI ACCTGC 1 cut(s) 736
Cac8I GCNNGC 3 cut(s) 125, 328, 465
CfoI GCGC 2 cut(s) 129, 745
Cfr13I GGNCC 2 cut(s) 154, 155
Csp6I GTAC 3 cut(s) 310, 358, 577
CspCI CAANNNNNGTGG 2 cut(s) 315, 350
CviAII CATG 5 cut(s) 130, 229, 298, 343, 650
CviJI RGCY 7 cut(s) 40, 101, 156, 216, 330, 609, 672
CviKI_1 RGCY 7 cut(s) 40, 101, 156, 216, 330, 609, 672
CviQI GTAC 3 cut(s) 310, 358, 577
DdeI CTNAG 3 cut(s) 102, 374, 471
DpnI GATC 3 cut(s) 69, 144, 693
DpnII GATC 3 cut(s) 67, 142, 691
Eco130I CCWWGG 1 cut(s) 572
Eco24I GRGCYC 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 154
EcoRII CCWGG 2 cut(s) 192, 604
EcoT14I CCWWGG 1 cut(s) 572
EcoT38I GRGCYC 1 cut(s) 158
ErhI CCWWGG 1 cut(s) 572
FaeI CATG 5 cut(s) 133, 232, 301, 346, 653
FaiI YATR 9 cut(s) 15, 131, 230, 299, 344, 517, 633, 651, 772
FalI AAGNNNNNCTT 2 cut(s) 260, 292
FaqI GGGAC 2 cut(s) 191, 596
FatI CATG 5 cut(s) 129, 228, 297, 342, 649
FriOI GRGCYC 1 cut(s) 158
FspBI CTAG 1 cut(s) 756
FspI TGCGCA 1 cut(s) 744
GlaI GCGC 2 cut(s) 128, 744
HaeIII GGCC 1 cut(s) 156
HhaI GCGC 2 cut(s) 129, 745
Hin1II CATG 5 cut(s) 133, 232, 301, 346, 653
Hin6I GCGC 2 cut(s) 127, 743
HinP1I GCGC 2 cut(s) 127, 743
HindIII AAGCTT 2 cut(s) 328, 670
HinfI GANTC 3 cut(s) 242, 584, 728
HphI GGTGA 2 cut(s) 44, 362
Hpy166II GTNNAC 3 cut(s) 47, 310, 566
Hpy188III TCNNGA 1 cut(s) 454
Hpy8I GTNNAC 3 cut(s) 47, 310, 566
HpyCH4III ACNGT 2 cut(s) 51, 323
HpyCH4V TGCA 7 cut(s) 62, 305, 326, 467, 519, 535, 649
HpyF3I CTNAG 3 cut(s) 102, 374, 471
Hsp92II CATG 5 cut(s) 133, 232, 301, 346, 653
HspAI GCGC 2 cut(s) 127, 743
Kzo9I GATC 3 cut(s) 67, 142, 691
LweI GCATC 2 cut(s) 18, 674
MaeI CTAG 1 cut(s) 756
MaeIII GTNAC 3 cut(s) 350, 503, 751
MalI GATC 3 cut(s) 69, 144, 693
MboI GATC 3 cut(s) 67, 142, 691
MboII GAAGA 3 cut(s) 209, 551, 719
MhlI GDGCHC 1 cut(s) 158
MluCI AATT 3 cut(s) 95, 182, 206
MlyI GAGTC 3 cut(s) 236, 578, 737
MmeI TCCRAC 1 cut(s) 719
MnlI CCTC 7 cut(s) 58, 383, 484, 494, 579, 624, 655
MroXI GAANNNNTTC 1 cut(s) 449
MseI TTAA 3 cut(s) 80, 219, 225
MspA1I CMGCKG 1 cut(s) 399
MspR9I CCNGG 2 cut(s) 194, 606
Mva1269I GAATGC 1 cut(s) 307
MvaI CCWGG 2 cut(s) 194, 606
NdeII GATC 3 cut(s) 67, 142, 691
NlaIII CATG 5 cut(s) 133, 232, 301, 346, 653
NlaIV GGNNCC 2 cut(s) 156, 191
NsbI TGCGCA 1 cut(s) 744
NspI RCATGY 1 cut(s) 232
PciI ACATGT 1 cut(s) 228
PctI GAATGC 1 cut(s) 307
PdmI GAANNNNTTC 1 cut(s) 449
PfoI TCCNGGA 1 cut(s) 192
PleI GAGTC 3 cut(s) 236, 578, 736
PpsI GAGTC 3 cut(s) 236, 578, 736
PscI ACATGT 1 cut(s) 228
Psp6I CCWGG 2 cut(s) 192, 604
PspGI CCWGG 2 cut(s) 192, 604
PspN4I GGNNCC 2 cut(s) 156, 191
PspOMI GGGCCC 1 cut(s) 154
PspPI GGNCC 2 cut(s) 154, 155
RsaI GTAC 3 cut(s) 311, 359, 578
RsaNI GTAC 3 cut(s) 310, 358, 577
SaqAI TTAA 3 cut(s) 80, 219, 225
Sau3AI GATC 3 cut(s) 67, 142, 691
Sau96I GGNCC 2 cut(s) 154, 155
SchI GAGTC 3 cut(s) 236, 578, 737
ScrFI CCNGG 2 cut(s) 194, 606
SduI GDGCHC 1 cut(s) 158
SfaNI GCATC 2 cut(s) 18, 674
Sse9I AATT 3 cut(s) 95, 182, 206
SsiI CCGC 2 cut(s) 399, 678
SspMI CTAG 1 cut(s) 756
StyD4I CCNGG 2 cut(s) 192, 604
StyI CCWWGG 1 cut(s) 572
TaaI ACNGT 2 cut(s) 51, 323
TaqI TCGA 2 cut(s) 53, 245
TasI AATT 3 cut(s) 95, 182, 206
TatI WGTACW 1 cut(s) 357
Tru1I TTAA 3 cut(s) 80, 219, 225
Tru9I TTAA 3 cut(s) 80, 219, 225
TscAI CASTG 2 cut(s) 312, 328
TspDTI ATGAA 3 cut(s) 146, 270, 314
TspRI CASTG 2 cut(s) 312, 328
XapI RAATTY 2 cut(s) 182, 206
XceI RCATGY 1 cut(s) 232
XcmI CCANNNNNNNNNTGG 1 cut(s) 647
XmnI GAANNNNTTC 1 cut(s) 449
XspI CTAG 1 cut(s) 756
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.