AT3G42560

endonuclease activity

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
14680265 .. 14680760
496 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G42560.1

Sequence Viewer

Length: 297 bp
ATGGAGAATGAGGGGATTGAACCAAACTTGATTATGTCGAATGTTTTGGTTAATGCATTTGGAACTGCTGGAAGCACATGGAAGCTCTCTCTATTTATCATCATATTAAAGAAACTGTATGTCTATCTTATTCGTGCGATTAAACTTCTAGGATACACCCCTGATGTGGTTACCTATAGTACACTTATGAAAGCATTCACTCGACCAAAGAAGTATGAAAAGGGAAATGGAAGCTTTTGGGTGTACGGTAGATCAGAAAGCAAGACAGCTATTGCAAAATGCTTTTATGGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.06

Weight (kDa)

9.64

Isoelectric Point (pI)

17.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 181, 245
AfiI CCNNNNNNNGG 1 cut(s) 166
AgsI TTSAA 1 cut(s) 20
AluBI AGCT 3 cut(s) 85, 234, 269
AluI AGCT 3 cut(s) 85, 234, 269
Asp700I GAANNNNTTC 1 cut(s) 194
BciVI GTATCC 1 cut(s) 146
BfaI CTAG 1 cut(s) 149
BfmI CTRYAG 1 cut(s) 175
BfuI GTATCC 1 cut(s) 146
Bsc4I CCNNNNNNNGG 1 cut(s) 166
BseLI CCNNNNNNNGG 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 166
BsmI GAATGC 1 cut(s) 194
Bsp143I GATC 1 cut(s) 251
BssMI GATC 1 cut(s) 251
Bst4CI ACNGT 2 cut(s) 117, 248
BstEII GGTNACC 1 cut(s) 169
BstKTI GATC 1 cut(s) 254
BstMBI GATC 1 cut(s) 251
BstPI GGTNACC 1 cut(s) 169
BstSFI CTRYAG 1 cut(s) 175
BsuI GTATCC 1 cut(s) 146
Csp6I GTAC 2 cut(s) 180, 244
CviAII CATG 1 cut(s) 78
CviJI RGCY 3 cut(s) 85, 234, 269
CviKI_1 RGCY 3 cut(s) 85, 234, 269
CviQI GTAC 2 cut(s) 180, 244
DpnI GATC 1 cut(s) 253
DpnII GATC 1 cut(s) 251
Eco91I GGTNACC 1 cut(s) 169
EcoO65I GGTNACC 1 cut(s) 169
EcoT22I ATGCAT 1 cut(s) 58
FaeI CATG 1 cut(s) 81
FaiI YATR 8 cut(s) 35, 79, 104, 120, 177, 188, 216, 288
FatI CATG 1 cut(s) 77
FspBI CTAG 1 cut(s) 149
Hin1II CATG 1 cut(s) 81
HindIII AAGCTT 1 cut(s) 232
Hpy166II GTNNAC 2 cut(s) 182, 244
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 1 cut(s) 294
Hpy8I GTNNAC 2 cut(s) 182, 244
HpyCH4III ACNGT 2 cut(s) 117, 248
HpyCH4V TGCA 2 cut(s) 56, 275
Hsp92II CATG 1 cut(s) 81
Kzo9I GATC 1 cut(s) 251
LpnPI CCDG 2 cut(s) 54, 174
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 169
MalI GATC 1 cut(s) 253
MboI GATC 1 cut(s) 251
MnlI CCTC 1 cut(s) 4
Mph1103I ATGCAT 1 cut(s) 58
MroXI GAANNNNTTC 1 cut(s) 194
MseI TTAA 3 cut(s) 51, 107, 141
Mva1269I GAATGC 1 cut(s) 194
NdeII GATC 1 cut(s) 251
NlaIII CATG 1 cut(s) 81
NsiI ATGCAT 1 cut(s) 58
PctI GAATGC 1 cut(s) 194
PdmI GAANNNNTTC 1 cut(s) 194
PspEI GGTNACC 1 cut(s) 169
RsaI GTAC 2 cut(s) 181, 245
RsaNI GTAC 2 cut(s) 180, 244
SaqAI TTAA 3 cut(s) 51, 107, 141
Sau3AI GATC 1 cut(s) 251
SetI ASST 4 cut(s) 87, 176, 236, 271
SfcI CTRYAG 1 cut(s) 175
SgeI CNNG 8 cut(s) 40, 81, 90, 146, 161, 173, 213, 274
SspMI CTAG 1 cut(s) 149
TaaI ACNGT 2 cut(s) 117, 248
TaqI TCGA 2 cut(s) 38, 202
TatI WGTACW 1 cut(s) 179
Tru1I TTAA 3 cut(s) 51, 107, 141
Tru9I TTAA 3 cut(s) 51, 107, 141
TspDTI ATGAA 2 cut(s) 203, 231
XmnI GAANNNNTTC 1 cut(s) 194
XspI CTAG 1 cut(s) 149
Zsp2I ATGCAT 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.