Rroxscaffold_5G00350710

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
25113191 .. 25113757
567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00350710.1

Sequence Viewer

Length: 258 bp
ATGTCCCAACTCTCGGAGAGGAAATTTCCTTTGAGTTATACAACCATTTGTTACAAGATTTTTTGTAGAGTTGGGCATGTTGATAAGGCCATGGCTCTTCTTGCTCGAATGGAAGCTCTTGGCTTTCGACCCAATTCGATATCCTACACTCGTTTAATTGATGCTCTAGGAAGTATTGGCAGGACTTTGGAAGCTGATGTGTTGTGGGGTTTAGGCCAAGAATTAAGCTTTACAATGTGTTGCTTAGAGGGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.54

Weight (kDa)

7.66

Isoelectric Point (pI)

23.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 20 - 56 2.9e-08 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 23
AfiI CCNNNNNNNGG 1 cut(s) 13
AluBI AGCT 3 cut(s) 116, 194, 228
AluI AGCT 3 cut(s) 116, 194, 228
AoxI GGCC 2 cut(s) 87, 214
ApoI RAATTY 1 cut(s) 23
BfaI CTAG 1 cut(s) 167
BmsI GCATC 1 cut(s) 151
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseDI CCNNGG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 13
BshFI GGCC 2 cut(s) 89, 216
BslI CCNNNNNNNGG 1 cut(s) 13
BsnI GGCC 2 cut(s) 89, 216
Bsp19I CCATGG 1 cut(s) 90
BspANI GGCC 2 cut(s) 89, 216
BspQI GCTCTTC 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 90
BssT1I CCWWGG 1 cut(s) 90
Bst6I CTCTTC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 244
BstDSI CCRYGG 1 cut(s) 90
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNSI RCATGY 1 cut(s) 80
BsuRI GGCC 2 cut(s) 89, 216
BtgI CCRYGG 1 cut(s) 90
CviAII CATG 2 cut(s) 77, 91
CviJI RGCY 7 cut(s) 89, 95, 116, 123, 194, 216, 228
CviKI_1 RGCY 7 cut(s) 89, 95, 116, 123, 194, 216, 228
DdeI CTNAG 1 cut(s) 244
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco130I CCWWGG 1 cut(s) 90
Eco32I GATATC 1 cut(s) 141
EcoRV GATATC 1 cut(s) 141
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 80, 94
FaiI YATR 3 cut(s) 39, 78, 92
FatI CATG 2 cut(s) 76, 90
FspBI CTAG 1 cut(s) 167
HaeIII GGCC 2 cut(s) 89, 216
Hin1II CATG 2 cut(s) 80, 94
HindIII AAGCTT 1 cut(s) 226
Hpy188I TCNGA 1 cut(s) 16
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 244
Hsp92II CATG 2 cut(s) 80, 94
LguI GCTCTTC 1 cut(s) 102
LpnPI CCDG 1 cut(s) 166
LweI GCATC 1 cut(s) 151
MaeI CTAG 1 cut(s) 167
MaeIII GTNAC 1 cut(s) 50
MboII GAAGA 1 cut(s) 89
MluCI AATT 4 cut(s) 23, 133, 156, 221
MnlI CCTC 2 cut(s) 12, 241
MseI TTAA 2 cut(s) 155, 224
MwoI GCNNNNNNNGC 1 cut(s) 101
NcoI CCATGG 1 cut(s) 90
NlaIII CATG 2 cut(s) 80, 94
NspI RCATGY 1 cut(s) 80
PciSI GCTCTTC 1 cut(s) 102
SapI GCTCTTC 1 cut(s) 102
SaqAI TTAA 2 cut(s) 155, 224
SetI ASST 3 cut(s) 118, 196, 230
SfaNI GCATC 1 cut(s) 151
Sse9I AATT 4 cut(s) 23, 133, 156, 221
SspMI CTAG 1 cut(s) 167
StyI CCWWGG 1 cut(s) 90
TaqI TCGA 3 cut(s) 106, 127, 137
TasI AATT 4 cut(s) 23, 133, 156, 221
Tru1I TTAA 2 cut(s) 155, 224
Tru9I TTAA 2 cut(s) 155, 224
XapI RAATTY 1 cut(s) 23
XceI RCATGY 1 cut(s) 80
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.