Rroxscaffold_3G00229630

Pentatricopeptide repeat domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
14178885 .. 14180924
2040 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00229630.1

Sequence Viewer

Length: 237 bp
ATGTTGAGAATAGGGCTGGTGCAAGCTCTAAAGGCTTTGGCCATAATTTCGGTGGAAGAGCGTAGGTTGGAAAGTGAGAGAGGGGACAATGGGATGTGGAAGAAAGCTATGGACATTGTGGAAGAGATAAGAGAAATGGGGATGGTATTAGACAAACAGATTTACAACGGCATTATTGATACATTTGGGAAATATGATGAGTTGAATGAAACATTGGAAGCTTGTGGAAACCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.89

Weight (kDa)

4.64

Isoelectric Point (pI)

35.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 39
AgsI TTSAA 1 cut(s) 205
AjuI GAANNNNNNNTTGG 2 cut(s) 197, 229
AluBI AGCT 3 cut(s) 26, 107, 221
AluI AGCT 3 cut(s) 26, 107, 221
AoxI GGCC 1 cut(s) 39
BalI TGGCCA 1 cut(s) 41
BccI CCATC 1 cut(s) 136
BceAI ACGGC 1 cut(s) 184
BseGI GGATG 2 cut(s) 99, 147
BshFI GGCC 1 cut(s) 41
BslFI GGGAC 1 cut(s) 98
BsmFI GGGAC 1 cut(s) 98
BsnI GGCC 1 cut(s) 41
BspANI GGCC 1 cut(s) 41
BspQI GCTCTTC 1 cut(s) 51
Bst6I CTCTTC 2 cut(s) 51, 117
BstC8I GCNNGC 1 cut(s) 24
BstF5I GGATG 2 cut(s) 99, 147
BstMWI GCNNNNNNNGC 1 cut(s) 32
BsuRI GGCC 1 cut(s) 41
BtsCI GGATG 2 cut(s) 99, 147
Cac8I GCNNGC 1 cut(s) 24
CviJI RGCY 6 cut(s) 16, 26, 35, 41, 107, 221
CviKI_1 RGCY 6 cut(s) 16, 26, 35, 41, 107, 221
EaeI YGGCCR 1 cut(s) 39
Eam1104I CTCTTC 2 cut(s) 51, 117
EarI CTCTTC 2 cut(s) 51, 117
FaiI YATR 3 cut(s) 44, 110, 195
FaqI GGGAC 1 cut(s) 98
FokI GGATG 2 cut(s) 106, 154
HaeIII GGCC 1 cut(s) 41
HindIII AAGCTT 1 cut(s) 219
HpyCH4V TGCA 1 cut(s) 22
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
LguI GCTCTTC 1 cut(s) 51
LpnPI CCDG 1 cut(s) 2
MboII GAAGA 3 cut(s) 68, 112, 134
MlsI TGGCCA 1 cut(s) 41
MluCI AATT 1 cut(s) 45
MluNI TGGCCA 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 1 cut(s) 74
Mox20I TGGCCA 1 cut(s) 41
MscI TGGCCA 1 cut(s) 41
MseI TTAA 1 cut(s) 235
Msp20I TGGCCA 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 32
PciSI GCTCTTC 1 cut(s) 51
SapI GCTCTTC 1 cut(s) 51
SaqAI TTAA 1 cut(s) 235
SetI ASST 5 cut(s) 28, 68, 109, 223, 234
SgeI CNNG 2 cut(s) 29, 35
Sse9I AATT 1 cut(s) 45
TasI AATT 1 cut(s) 45
Tru1I TTAA 1 cut(s) 235
Tru9I TTAA 1 cut(s) 235
TspDTI ATGAA 1 cut(s) 222
XcmI CCANNNNNNNNNTGG 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.