Rh1AG467800

Pentatricopeptide repeat domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0002642
Physical Location & Seq
Forward (+)
68170251 .. 68170880
630 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG467800.1

Sequence Viewer

Length: 630 bp
ATGATATTTGTGGGGTTTAGGCCAAGAATTAAGCTTTACGATGTGTTGCTTGGAGGGTTTTTGAAGAAAGGTTTGTTAGGACTTGCAATTAGAGTTTTGGGGGTAATGGGTGATTTGGGTACTGAGAGAAATCAAGAAACTTATGAGATTTTACTTGATTACTATGTCAATGCTGGGAGGTTGGAGGATACTTGGTCAATGGTTAATGAGATGAAGCGGAAGAGGTTTCGGCTGGGATCATTTGTGTATGGTAAGGCTATTGGTCTTTATAGGGACAATGGGATGTGGAAGAAAGCAATGGACATTGTGGAAGAGATAAGAGAAACGGGGATGGTATTAGACAAACAGATTTACAACAGCATTATTGATACATTTGGGAAATATGGCGACTTGGATGAAGCATTGGAAGTGTTTGGGAAAATGAAACAAGAACGTGTAAGGCCTGATATTTCGACCTTTAATTCGTTGATAAGGTGGCACTGTAAGTCTGGGTTGTTAAAGAAGGCCCTTGAGTTGTTTACCGAGATGCAAGAACAAGGATTATATCCTGATCCGAAAATGATTGTTACTATTATCAGTAGATTGGGGGAGCAAGGGAAGTGGGATATATATGATACAGAAGACCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

209

Amino Acids

24.26

Weight (kDa)

6.64

Isoelectric Point (pI)

29.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 44 - 80 2.8e-06 PPR repeat family
TPR_24 PF23276 93 - 158 3.3e-06 Fungal tetratrico peptide repeats
PPR_3 PF13812 102 - 158 2.3e-11 Pentatricopeptide repeat domain
PPR_1 PF12854 110 - 142 8.9e-07 PPR repeat
PPR_2 PF13041 117 - 158 4.4e-11 PPR repeat family
PPR PF01535 117 - 145 4.8e-07 PPR repeat
PPR_1 PF12854 146 - 177 1.5e-09 PPR repeat
PPR_2 PF13041 148 - 184 4.3e-11 PPR repeat family
PPR PF01535 151 - 181 4.5e-09 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 217
AclWI GGATC 2 cut(s) 244, 545
AfaI GTAC 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 433
AgsI TTSAA 1 cut(s) 64
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AlwI GGATC 2 cut(s) 244, 545
AoxI GGCC 3 cut(s) 20, 440, 504
ArsI GACNNNNNNTTYG 2 cut(s) 445, 477
AspS9I GGNCC 1 cut(s) 505
AsuHPI GGTGA 1 cut(s) 122
BccI CCATC 1 cut(s) 325
BciVI GTATCC 1 cut(s) 181
BfuI GTATCC 1 cut(s) 181
BmgT120I GGNCC 1 cut(s) 505
BmsI GCATC 1 cut(s) 516
BpuEI CTTGAG 1 cut(s) 530
Bse3DI GCAATG 1 cut(s) 303
BseGI GGATG 3 cut(s) 288, 336, 400
BseMI GCAATG 1 cut(s) 303
BseMII CTCAG 1 cut(s) 114
BseYI CCCAGC 2 cut(s) 173, 232
BshFI GGCC 3 cut(s) 22, 442, 506
BslFI GGGAC 1 cut(s) 287
BsmFI GGGAC 1 cut(s) 287
BsnI GGCC 3 cut(s) 22, 442, 506
Bsp143I GATC 2 cut(s) 236, 550
BspACI CCGC 1 cut(s) 217
BspANI GGCC 3 cut(s) 22, 442, 506
BspCNI CTCAG 1 cut(s) 115
BspPI GGATC 2 cut(s) 244, 545
BsrDI GCAATG 1 cut(s) 303
BssMI GATC 2 cut(s) 236, 550
Bst4CI ACNGT 1 cut(s) 482
Bst6I CTCTTC 2 cut(s) 215, 306
BstDEI CTNAG 1 cut(s) 123
BstF5I GGATG 3 cut(s) 288, 336, 400
BstKTI GATC 2 cut(s) 239, 553
BstMBI GATC 2 cut(s) 236, 550
BsuI GTATCC 1 cut(s) 181
BsuRI GGCC 3 cut(s) 22, 442, 506
BtsCI GGATG 3 cut(s) 288, 336, 400
BtsIMutI CAGTG 1 cut(s) 478
Cfr13I GGNCC 1 cut(s) 505
Csp6I GTAC 1 cut(s) 120
CspCI CAANNNNNGTGG 2 cut(s) 581, 616
CviJI RGCY 6 cut(s) 22, 34, 232, 257, 442, 506
CviKI_1 RGCY 6 cut(s) 22, 34, 232, 257, 442, 506
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 1 cut(s) 123
DpnI GATC 2 cut(s) 238, 552
DpnII GATC 2 cut(s) 236, 550
Eam1104I CTCTTC 2 cut(s) 215, 306
EarI CTCTTC 2 cut(s) 215, 306
Eco147I AGGCCT 1 cut(s) 442
EcoO109I RGGNCCY 1 cut(s) 505
FaiI YATR 9 cut(s) 144, 165, 249, 270, 384, 544, 608, 610, 612
FaqI GGGAC 1 cut(s) 287
FokI GGATG 3 cut(s) 295, 343, 407
GsaI CCCAGC 2 cut(s) 177, 236
HaeIII GGCC 3 cut(s) 22, 442, 506
HindIII AAGCTT 1 cut(s) 32
HphI GGTGA 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 519
Hpy188I TCNGA 1 cut(s) 555
Hpy188III TCNNGA 2 cut(s) 134, 548
Hpy8I GTNNAC 1 cut(s) 519
HpyAV CCTTC 1 cut(s) 496
HpyCH4III ACNGT 1 cut(s) 482
HpyCH4IV ACGT 1 cut(s) 433
HpyCH4V TGCA 2 cut(s) 86, 529
HpyF3I CTNAG 1 cut(s) 123
HpySE526I ACGT 1 cut(s) 433
Kzo9I GATC 2 cut(s) 236, 550
LmnI GCTCC 1 cut(s) 589
LpnPI CCDG 5 cut(s) 159, 218, 456, 474, 561
LweI GCATC 1 cut(s) 516
MaeII ACGT 1 cut(s) 433
MaeIII GTNAC 1 cut(s) 565
MalI GATC 2 cut(s) 238, 552
MboI GATC 2 cut(s) 236, 550
MboII GAAGA 4 cut(s) 76, 232, 301, 323
MluCI AATT 3 cut(s) 27, 87, 460
MmeI TCCRAC 1 cut(s) 162
MnlI CCTC 4 cut(s) 47, 171, 178, 216
MseI TTAA 4 cut(s) 30, 204, 459, 497
NdeII GATC 2 cut(s) 236, 550
PceI AGGCCT 1 cut(s) 442
PspFI CCCAGC 2 cut(s) 173, 232
PspPI GGNCC 1 cut(s) 505
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 4 cut(s) 30, 204, 459, 497
Sau3AI GATC 2 cut(s) 236, 550
Sau96I GGNCC 1 cut(s) 505
SetI ASST 7 cut(s) 36, 73, 182, 227, 436, 458, 476
SfaNI GCATC 1 cut(s) 516
SmlI CTYRAG 1 cut(s) 509
SmoI CTYRAG 1 cut(s) 509
Sse9I AATT 3 cut(s) 27, 87, 460
SseBI AGGCCT 1 cut(s) 442
SsiI CCGC 1 cut(s) 217
StuI AGGCCT 1 cut(s) 442
TaaI ACNGT 1 cut(s) 482
TaiI ACGT 1 cut(s) 436
TaqI TCGA 1 cut(s) 452
TasI AATT 3 cut(s) 27, 87, 460
Tru1I TTAA 4 cut(s) 30, 204, 459, 497
Tru9I TTAA 4 cut(s) 30, 204, 459, 497
TscAI CASTG 1 cut(s) 485
TspDTI ATGAA 3 cut(s) 227, 411, 437
TspRI CASTG 1 cut(s) 485
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.