Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0001961

Physical Location & Seq

Genomic Coordinates Forward (+)

395931 .. 396357

Gene Structure 427 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT4G00925.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 126 bp

ATGGTTCCCAAGTTCGTAAGAAAATGGAGAAGTGAGGAAGATTCCGATGGTAATCTCCAAGCCAAGAGAATCATGCATCGAAACAAAAGTTTAGTTCCATATATTGTAAAGAGAATTAAGTATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009526 GO:0009536 GO:0009941 GO:0031967 GO:0031975 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CBS CorC_HlyC DUF21

Protein Analysis

41

Amino Acids

5.02

Weight (kDa)

10.44

Isoelectric Point (pI)

91.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001961)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G00925
fragaria_vesca	FvH4_3g24130 FvH4_3g24130 FvH4_3g24130 FvH4_3g24130 FvH4_3g24130
rosa_chinensis	RchiOBHm_Chr5g0042791 RchiOBHm_Chr5g0042841 RchiOBHm_Chr5g0043091 RchiOBHm_Chr5g0043121 RchiOBHm_Chr5g0043141
rosa_laevigata	RLG00000034152 RLG00000034154 RLG00000034159 RLG00000034161 RLG00000034162 RLG00000034165
rosa_multiflora	Rmu_sc0000493.1_g000029 Rmu_sc0002079.1_g000002 Rmu_sc0004950.1_g000009 Rmu_sc0008148.1_g000050 Rmu_sc0027101.1_g000001
rosa_roxburghii	Rroxscaffold_1G00037670 Rroxscaffold_1G00037710 Rroxscaffold_1G00037760 Rroxscaffold_1G00037830 Rroxscaffold_7G00212010
rosa_rugosa	Rorug03G0298700 Rorug05G0204300 Rorug05G0204500 Rorug05G0276100 Rorug05G0308400
rosa_samantha	Rh5AG289500 Rh5BG293600 Rh5BG293900 Rh5BG295600 Rh5BG295800 Rh5BG296100 Rh5CG290900 Rh5CG326200 Rh5DG303600 Rh5DG305300 Rh6AG419200 Rh6BG071100
rosa_wichuraiana	Rw5G026820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
BccI	CCATC	1 cut(s)	41
BmiI	GGNNCC	1 cut(s)	6
BmsI	GCATC	1 cut(s)	85
BsaBI	GATNNNNATC	1 cut(s)	51
Bse8I	GATNNNNATC	1 cut(s)	51
BseJI	GATNNNNATC	1 cut(s)	51
BspLI	GGNNCC	1 cut(s)	6
CviAII	CATG	1 cut(s)	73
CviJI	RGCY	1 cut(s)	62
CviKI_1	RGCY	1 cut(s)	62
EcoT22I	ATGCAT	1 cut(s)	78
FaeI	CATG	1 cut(s)	76
FaiI	YATR	3 cut(s)	74, 100, 102
FatI	CATG	1 cut(s)	72
FspEI	CC	9 cut(s)	10, 20, 21, 22, 33, 58, 71, 76, 111
Hin1II	CATG	1 cut(s)	76
HinfI	GANTC	2 cut(s)	41, 69
Hpy188I	TCNGA	1 cut(s)	46
HpyCH4V	TGCA	1 cut(s)	76
Hsp92II	CATG	1 cut(s)	76
LweI	GCATC	1 cut(s)	85
MboII	GAAGA	1 cut(s)	50
MluCI	AATT	1 cut(s)	114
MnlI	CCTC	1 cut(s)	28
Mph1103I	ATGCAT	1 cut(s)	78
MseI	TTAA	1 cut(s)	117
NlaIII	CATG	1 cut(s)	76
NlaIV	GGNNCC	1 cut(s)	6
NsiI	ATGCAT	1 cut(s)	78
PfeI	GAWTC	2 cut(s)	41, 69
PspN4I	GGNNCC	1 cut(s)	6
SaqAI	TTAA	1 cut(s)	117
SfaNI	GCATC	1 cut(s)	85
SgeI	CNNG	4 cut(s)	22, 71, 76, 85
Sse9I	AATT	1 cut(s)	114
TaqI	TCGA	1 cut(s)	79
TasI	AATT	1 cut(s)	114
TfiI	GAWTC	2 cut(s)	41, 69
Tru1I	TTAA	1 cut(s)	117
Tru9I	TTAA	1 cut(s)	117
Zsp2I	ATGCAT	1 cut(s)	78

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.