Rroxscaffold_7G00212010

DUF21 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
62442639 .. 62444069
1431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00212010.1

Sequence Viewer

Length: 183 bp
ATGGCTCAGAAACCTGGTTACTTTGTGCTGGATTCAATGTCAGTCTGGAATCTTCTTAGAGAATTCCGCATTCGGAAGGTTCACATGGCTGTGGTTCTCAATGAATATGGTGGAACTGTAGGGATAATTACCCTAGAAGATGTGGTGGAGGAAATTGTTGGTAAACTTTCGTACCCTTTTTAG

Protein Analysis

60

Amino Acids

6.86

Weight (kDa)

5.64

Isoelectric Point (pI)

33.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CBS PF00571 8 - 53 2.4e-07 CBS domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 67
AcsI RAATTY 1 cut(s) 62
AfaI GTAC 1 cut(s) 173
AgsI TTSAA 1 cut(s) 36
AjnI CCWGG 1 cut(s) 13
ApoI RAATTY 1 cut(s) 62
BaeI ACNNNNGTAYC 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 15
BfaI CTAG 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 15
BseBI CCWGG 1 cut(s) 15
BseMII CTCAG 1 cut(s) 20
BsmI GAATGC 1 cut(s) 69
BspACI CCGC 1 cut(s) 67
BspCNI CTCAG 1 cut(s) 19
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 118
BstDEI CTNAG 2 cut(s) 6, 56
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 117
CsiI ACCWGGT 1 cut(s) 13
Csp6I GTAC 1 cut(s) 172
CviAII CATG 1 cut(s) 85
CviJI RGCY 2 cut(s) 5, 89
CviKI_1 RGCY 2 cut(s) 5, 89
CviQI GTAC 1 cut(s) 172
DdeI CTNAG 2 cut(s) 6, 56
EcoRI GAATTC 1 cut(s) 62
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 1 cut(s) 88
FaiI YATR 2 cut(s) 86, 108
FatI CATG 1 cut(s) 84
FspBI CTAG 1 cut(s) 134
Hin1II CATG 1 cut(s) 88
HinfI GANTC 2 cut(s) 32, 49
Hpy166II GTNNAC 2 cut(s) 82, 164
Hpy188I TCNGA 2 cut(s) 9, 75
Hpy188III TCNNGA 1 cut(s) 46
Hpy8I GTNNAC 2 cut(s) 82, 164
HpyAV CCTTC 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 118
HpyF3I CTNAG 2 cut(s) 6, 56
Hsp92II CATG 1 cut(s) 88
LpnPI CCDG 3 cut(s) 14, 27, 31
MabI ACCWGGT 1 cut(s) 13
MaeI CTAG 1 cut(s) 134
MaeIII GTNAC 1 cut(s) 17
MboII GAAGA 2 cut(s) 44, 149
MluCI AATT 3 cut(s) 62, 126, 153
MnlI CCTC 1 cut(s) 142
MslI CAYNNNNRTG 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 69
MvaI CCWGG 1 cut(s) 15
NlaIII CATG 1 cut(s) 88
PctI GAATGC 1 cut(s) 69
PfeI GAWTC 2 cut(s) 32, 49
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 15
SetI ASST 2 cut(s) 16, 81
SexAI ACCWGGT 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 117
SgeI CNNG 6 cut(s) 26, 27, 41, 58, 97, 146
SmiMI CAYNNNNRTG 1 cut(s) 89
Sse9I AATT 3 cut(s) 62, 126, 153
SsiI CCGC 1 cut(s) 67
SspMI CTAG 1 cut(s) 134
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 118
TasI AATT 3 cut(s) 62, 126, 153
TfiI GAWTC 2 cut(s) 32, 49
TspDTI ATGAA 1 cut(s) 117
XapI RAATTY 1 cut(s) 62
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.