Rmu_sc0027101.1_g000001

Transporter associated domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027101.1
Physical Location & Seq
Forward (+)
1 .. 878
878 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027101.1_g000001.1.cds

Sequence Viewer

Length: 279 bp
attcaatgtcagtctggaatcttcttagagaattccgcattcggaaggttcacatgcatggctgtggttctcaatgaatatggtggaactgtagggataattaccctagaagatgtggtggaggaaattgttggtgaaatatttgatgaaaatgattccaaggtacggtctttcgtctacctctctgatatgtcgttgacaatagaagcggcaaagggcacgagggcagctagggctatggtcctagcatctcgtctaataatactaatcaaggcttag

Protein Analysis

92

Amino Acids

10.02

Weight (kDa)

4.65

Isoelectric Point (pI)

39.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 177
AciI CCGC 2 cut(s) 36, 209
AcsI RAATTY 1 cut(s) 31
AfaI GTAC 1 cut(s) 165
AfiI CCNNNNNNNGG 1 cut(s) 165
AgsI TTSAA 1 cut(s) 5
AluBI AGCT 1 cut(s) 230
AluI AGCT 1 cut(s) 230
ApeKI GCWGC 1 cut(s) 227
ApoI RAATTY 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 241
AsuHPI GGTGA 1 cut(s) 146
AvaII GGWCC 1 cut(s) 241
BaeGI GKGCMC 1 cut(s) 221
BauI CACGAG 1 cut(s) 220
BbvI GCAGC 1 cut(s) 239
BfaI CTAG 3 cut(s) 107, 231, 245
BfmI CTRYAG 1 cut(s) 90
BisI GCNGC 2 cut(s) 210, 228
BlsI GCNGC 2 cut(s) 211, 229
Bme18I GGWCC 1 cut(s) 241
BmgT120I GGNCC 1 cut(s) 241
BmsI GCATC 1 cut(s) 257
BsaJI CCNNGG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 159
BseLI CCNNNNNNNGG 1 cut(s) 165
BseSI GKGCMC 1 cut(s) 221
BseXI GCAGC 1 cut(s) 239
BslI CCNNNNNNNGG 1 cut(s) 165
BsmI GAATGC 1 cut(s) 38
Bsp1286I GDGCHC 1 cut(s) 221
BspACI CCGC 2 cut(s) 36, 209
BssECI CCNNGG 1 cut(s) 159
BssSI CACGAG 1 cut(s) 220
BssT1I CCWWGG 1 cut(s) 159
Bst2BI CACGAG 1 cut(s) 220
Bst4CI ACNGT 2 cut(s) 91, 168
BstDEI CTNAG 2 cut(s) 25, 276
BstMWI GCNNNNNNNGC 1 cut(s) 233
BstNSI RCATGY 1 cut(s) 57
BstSFI CTRYAG 1 cut(s) 90
BstSLI GKGCMC 1 cut(s) 221
BstV1I GCAGC 1 cut(s) 239
Cfr13I GGNCC 1 cut(s) 241
Csp6I GTAC 1 cut(s) 164
CviAII CATG 2 cut(s) 54, 58
CviJI RGCY 4 cut(s) 62, 230, 236, 275
CviKI_1 RGCY 4 cut(s) 62, 230, 236, 275
CviQI GTAC 1 cut(s) 164
DdeI CTNAG 2 cut(s) 25, 276
Eco130I CCWWGG 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 241
EcoRI GAATTC 1 cut(s) 31
EcoT14I CCWWGG 1 cut(s) 159
EcoT22I ATGCAT 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 159
FaeI CATG 2 cut(s) 57, 61
FaiI YATR 5 cut(s) 55, 59, 81, 191, 239
FatI CATG 2 cut(s) 53, 57
FblI GTMKAC 1 cut(s) 177
Fnu4HI GCNGC 2 cut(s) 210, 228
Fsp4HI GCNGC 2 cut(s) 210, 228
FspBI CTAG 3 cut(s) 107, 231, 245
GluI GCNGC 2 cut(s) 210, 228
Hin1II CATG 2 cut(s) 57, 61
HincII GTYRAC 1 cut(s) 198
HindII GTYRAC 1 cut(s) 198
HinfI GANTC 2 cut(s) 18, 155
HphI GGTGA 1 cut(s) 146
Hpy166II GTNNAC 3 cut(s) 51, 178, 198
Hpy188I TCNGA 2 cut(s) 44, 187
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 3 cut(s) 51, 178, 198
HpyAV CCTTC 1 cut(s) 39
HpyCH4III ACNGT 2 cut(s) 91, 168
HpyCH4V TGCA 1 cut(s) 57
HpyF10VI GCNNNNNNNGC 1 cut(s) 233
HpyF3I CTNAG 2 cut(s) 25, 276
Hsp92II CATG 2 cut(s) 57, 61
Lsp1109I GCAGC 1 cut(s) 239
LweI GCATC 1 cut(s) 257
MaeI CTAG 3 cut(s) 107, 231, 245
MboII GAAGA 2 cut(s) 13, 122
MhlI GDGCHC 1 cut(s) 221
MluCI AATT 3 cut(s) 31, 99, 126
MnlI CCTC 3 cut(s) 115, 191, 216
Mph1103I ATGCAT 1 cut(s) 59
MslI CAYNNNNRTG 2 cut(s) 56, 62
Mva1269I GAATGC 1 cut(s) 38
MwoI GCNNNNNNNGC 1 cut(s) 233
NlaIII CATG 2 cut(s) 57, 61
NsiI ATGCAT 1 cut(s) 59
NspI RCATGY 1 cut(s) 57
PctI GAATGC 1 cut(s) 38
PfeI GAWTC 2 cut(s) 18, 155
PkrI GCNGC 2 cut(s) 211, 229
PspPI GGNCC 1 cut(s) 241
RsaI GTAC 1 cut(s) 165
RsaNI GTAC 1 cut(s) 164
RseI CAYNNNNRTG 2 cut(s) 56, 62
SatI GCNGC 2 cut(s) 210, 228
Sau96I GGNCC 1 cut(s) 241
SduI GDGCHC 1 cut(s) 221
SetI ASST 4 cut(s) 50, 165, 183, 232
SfaNI GCATC 1 cut(s) 257
SfcI CTRYAG 1 cut(s) 90
SinI GGWCC 1 cut(s) 241
SmiMI CAYNNNNRTG 2 cut(s) 56, 62
Sse9I AATT 3 cut(s) 31, 99, 126
SsiI CCGC 2 cut(s) 36, 209
SspI AATATT 1 cut(s) 141
SspMI CTAG 3 cut(s) 107, 231, 245
StyI CCWWGG 1 cut(s) 159
TaaI ACNGT 2 cut(s) 91, 168
TasI AATT 3 cut(s) 31, 99, 126
TauI GCSGC 1 cut(s) 212
TfiI GAWTC 2 cut(s) 18, 155
TseI GCWGC 1 cut(s) 227
TspDTI ATGAA 2 cut(s) 90, 162
VpaK11BI GGWCC 1 cut(s) 241
XapI RAATTY 1 cut(s) 31
XceI RCATGY 1 cut(s) 57
XmiI GTMKAC 1 cut(s) 177
XspI CTAG 3 cut(s) 107, 231, 245
Zsp2I ATGCAT 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.