FvH4_3g40460

Non-specific lipid-transfer protein 1-like

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
34155558 .. 34156554
997 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g40460.t1

Sequence Viewer

Length: 360 bp
ATGGCCAGATTTCAAGTTGGTGTTGCGTTCATGGTTTTACTAATATCCATGGCGATGACCACTCCTTATGTCACTAAAGCAACCATAACTTGCGGTGAGGTGACGACCTTACTCACTCCCTGCATTCCATTTGGAGTGTTGGGAGGGATCGTGCTGCCGGATTGTTGTGCCGGGATCAAGGGGCTCAATGCTGCACAAAATACGACAGAGGATCGAAGAACGGCTTGTACTTGCATTCAAGAAGGAGCAGCTAGGATTCCTGGGATTGATTATGATCGTATAAACATGCTGGGCGATCTTTGTGGTTCTCCTTGTCCCTACAAAGTTTATCCATCTACTGATTGCTCTCAGGTAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

12.59

Weight (kDa)

5.13

Isoelectric Point (pI)

28.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 31 - 115 2.1e-06 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 93
AclWI GGATC 3 cut(s) 155, 182, 219
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 229
AgsI TTSAA 2 cut(s) 14, 239
AjnI CCWGG 1 cut(s) 259
AluBI AGCT 2 cut(s) 251, 357
AluI AGCT 2 cut(s) 251, 357
AlwI GGATC 3 cut(s) 155, 182, 219
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 3 cut(s) 154, 191, 248
AsuC2I CCSGG 1 cut(s) 172
AsuHPI GGTGA 2 cut(s) 107, 112
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 186
BbvI GCAGC 3 cut(s) 141, 178, 260
BccI CCATC 1 cut(s) 340
BceAI ACGGC 1 cut(s) 237
BciT130I CCWGG 1 cut(s) 261
BcnI CCSGG 1 cut(s) 172
BfaI CTAG 1 cut(s) 252
BisI GCNGC 3 cut(s) 155, 192, 249
BlsI GCNGC 3 cut(s) 156, 193, 250
Bme1390I CCNGG 2 cut(s) 172, 261
BmrFI CCNGG 2 cut(s) 172, 261
BpuMI CCSGG 1 cut(s) 172
BsaBI GATNNNNATC 1 cut(s) 273
BsaJI CCNNGG 2 cut(s) 48, 260
BsaXI ACNNNNNCTCC 2 cut(s) 135, 165
Bse8I GATNNNNATC 1 cut(s) 273
BseBI CCWGG 1 cut(s) 261
BseDI CCNNGG 2 cut(s) 48, 260
BseJI GATNNNNATC 1 cut(s) 273
BseXI GCAGC 3 cut(s) 141, 178, 260
BseYI CCCAGC 1 cut(s) 289
BsgI GTGCAG 1 cut(s) 177
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 2 cut(s) 158, 171
BslFI GGGAC 1 cut(s) 300
BsmFI GGGAC 1 cut(s) 300
BsmI GAATGC 2 cut(s) 123, 234
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 186
Bsp143I GATC 5 cut(s) 147, 174, 211, 274, 295
Bsp19I CCATGG 1 cut(s) 48
BspACI CCGC 1 cut(s) 93
BspANI GGCC 1 cut(s) 5
BspPI GGATC 3 cut(s) 155, 182, 219
BssECI CCNNGG 2 cut(s) 48, 260
BssMI GATC 5 cut(s) 147, 174, 211, 274, 295
BssT1I CCWWGG 1 cut(s) 48
Bst2UI CCWGG 1 cut(s) 261
BstDEI CTNAG 1 cut(s) 348
BstDSI CCRYGG 1 cut(s) 48
BstKTI GATC 5 cut(s) 150, 177, 214, 277, 298
BstMBI GATC 5 cut(s) 147, 174, 211, 274, 295
BstNI CCWGG 1 cut(s) 261
BstNSI RCATGY 1 cut(s) 289
BstSCI CCNGG 2 cut(s) 170, 259
BstV1I GCAGC 3 cut(s) 141, 178, 260
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 48
BtgZI GCGATG 1 cut(s) 68
Csp6I GTAC 1 cut(s) 228
CviAII CATG 3 cut(s) 31, 49, 286
CviJI RGCY 5 cut(s) 5, 184, 224, 251, 357
CviKI_1 RGCY 5 cut(s) 5, 184, 224, 251, 357
CviQI GTAC 1 cut(s) 228
DdeI CTNAG 1 cut(s) 348
DpnI GATC 5 cut(s) 149, 176, 213, 276, 297
DpnII GATC 5 cut(s) 147, 174, 211, 274, 295
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 48
Eco24I GRGCYC 1 cut(s) 186
EcoRII CCWGG 1 cut(s) 259
EcoT14I CCWWGG 1 cut(s) 48
EcoT38I GRGCYC 1 cut(s) 186
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 3 cut(s) 34, 52, 289
FaiI YATR 7 cut(s) 32, 50, 69, 86, 273, 281, 287
FalI AAGNNNNNCTT 2 cut(s) 208, 240
FaqI GGGAC 1 cut(s) 300
FatI CATG 3 cut(s) 30, 48, 285
Fnu4HI GCNGC 3 cut(s) 155, 192, 249
FriOI GRGCYC 1 cut(s) 186
Fsp4HI GCNGC 3 cut(s) 155, 192, 249
FspBI CTAG 1 cut(s) 252
GluI GCNGC 3 cut(s) 155, 192, 249
GsaI CCCAGC 1 cut(s) 293
HaeIII GGCC 1 cut(s) 5
HapII CCGG 2 cut(s) 158, 171
Hin1II CATG 3 cut(s) 34, 52, 289
HinfI GANTC 1 cut(s) 256
HpaII CCGG 2 cut(s) 158, 171
HphI GGTGA 2 cut(s) 107, 112
Hpy188III TCNNGA 1 cut(s) 239
HpyAV CCTTC 1 cut(s) 236
HpyCH4V TGCA 3 cut(s) 123, 194, 234
HpyF3I CTNAG 1 cut(s) 348
Hsp92II CATG 3 cut(s) 34, 52, 289
Kzo9I GATC 5 cut(s) 147, 174, 211, 274, 295
LmnI GCTCC 1 cut(s) 245
LpnPI CCDG 8 cut(s) 19, 133, 171, 184, 246, 273, 275, 335
Lsp1109I GCAGC 3 cut(s) 141, 178, 260
MaeI CTAG 1 cut(s) 252
MaeIII GTNAC 2 cut(s) 70, 100
MalI GATC 5 cut(s) 149, 176, 213, 276, 297
MboI GATC 5 cut(s) 147, 174, 211, 274, 295
MboII GAAGA 1 cut(s) 228
MhlI GDGCHC 1 cut(s) 186
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 3 cut(s) 91, 137, 202
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 53
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 2 cut(s) 158, 171
MspR9I CCNGG 2 cut(s) 172, 261
Mva1269I GAATGC 2 cut(s) 123, 234
MvaI CCWGG 1 cut(s) 261
NciI CCSGG 1 cut(s) 172
NcoI CCATGG 1 cut(s) 48
NdeII GATC 5 cut(s) 147, 174, 211, 274, 295
NlaIII CATG 3 cut(s) 34, 52, 289
NmuCI GTSAC 2 cut(s) 70, 100
NspI RCATGY 1 cut(s) 289
PctI GAATGC 2 cut(s) 123, 234
PfeI GAWTC 1 cut(s) 256
PkrI GCNGC 3 cut(s) 156, 193, 250
Psp6I CCWGG 1 cut(s) 259
PspFI CCCAGC 1 cut(s) 289
PspGI CCWGG 1 cut(s) 259
PsrI GAACNNNNNNTAC 2 cut(s) 211, 243
RsaI GTAC 1 cut(s) 229
RsaNI GTAC 1 cut(s) 228
RseI CAYNNNNRTG 1 cut(s) 53
SatI GCNGC 3 cut(s) 155, 192, 249
Sau3AI GATC 5 cut(s) 147, 174, 211, 274, 295
ScrFI CCNGG 2 cut(s) 172, 261
SduI GDGCHC 1 cut(s) 186
SetI ASST 5 cut(s) 102, 110, 253, 354, 359
SmiMI CAYNNNNRTG 1 cut(s) 53
SsiI CCGC 1 cut(s) 93
SspMI CTAG 1 cut(s) 252
StyD4I CCNGG 2 cut(s) 170, 259
StyI CCWWGG 1 cut(s) 48
TaqI TCGA 1 cut(s) 214
TatI WGTACW 1 cut(s) 227
TfiI GAWTC 1 cut(s) 256
TseFI GTSAC 2 cut(s) 70, 100
TseI GCWGC 3 cut(s) 154, 191, 248
Tsp45I GTSAC 2 cut(s) 70, 100
TspDTI ATGAA 1 cut(s) 19
XceI RCATGY 1 cut(s) 289
XspI CTAG 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.