MD11G1054100.v1.1

Non-specific lipid-transfer protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0003691
Physical Location & Seq
Reverse (-)
4611387 .. 4612558
1172 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1054100.v1.1.491

Sequence Viewer

Length: 348 bp
ATGGCCAGGTTTTCGGTCATCGTGGCAATAGTGTTCTTATTTGTGATAGCTCCTTTTGTCAGTAATGCCACCATAACTTGTGGTGAAGTGGTAGCTTGGCTCACTCCATGCATACCCTTTGGAGTGTTTGGAGGCACAGTGCCTCCAGATTGCTGTAAAGGCATAAAAGAGCTGAATGCTGCACAAAACACGACGATGGACCGGAGAATTGCTTGCAGTTGCATTCAGGAAGGAGCTGCAGCAATCCCCGGGATTAATTATGACCGGATTAACACTCTTGGTGATGTCTGTGGCTCTCCTTGTCCTTACAAAGTTTACCCCTCTACAAATTGCTCTGCGGTAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Tryp_alpha_amyl

Protein Analysis

116

Amino Acids

12.11

Weight (kDa)

6.06

Isoelectric Point (pI)

30.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 27 - 111 2.2e-07 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 338
AcoI YGGCCR 1 cut(s) 3
AjnI CCWGG 1 cut(s) 5
AluBI AGCT 5 cut(s) 50, 95, 172, 236, 345
AluI AGCT 5 cut(s) 50, 95, 172, 236, 345
Ama87I CYCGRG 1 cut(s) 248
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 3 cut(s) 179, 236, 239
AseI ATTAAT 1 cut(s) 255
AspS9I GGNCC 1 cut(s) 199
AsuC2I CCSGG 2 cut(s) 249, 250
AsuHPI GGTGA 2 cut(s) 95, 293
AvaI CYCGRG 1 cut(s) 248
AvaII GGWCC 1 cut(s) 199
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 3 cut(s) 166, 223, 251
BccI CCATC 1 cut(s) 190
BciT130I CCWGG 1 cut(s) 7
BcnI CCSGG 2 cut(s) 249, 250
BfmI CTRYAG 1 cut(s) 237
BisI GCNGC 3 cut(s) 180, 237, 240
BlsI GCNGC 3 cut(s) 181, 238, 241
Bme1390I CCNGG 3 cut(s) 7, 249, 250
Bme18I GGWCC 1 cut(s) 199
BmeT110I CYCGRG 1 cut(s) 248
BmgT120I GGNCC 1 cut(s) 199
BmrFI CCNGG 3 cut(s) 7, 249, 250
BpmI CTGGAG 1 cut(s) 129
BpuMI CCSGG 2 cut(s) 249, 250
BsaJI CCNNGG 2 cut(s) 247, 248
BsaWI WCCGGW 2 cut(s) 201, 264
BsaXI ACNNNNNCTCC 4 cut(s) 123, 127, 153, 157
BseBI CCWGG 1 cut(s) 7
BseDI CCNNGG 2 cut(s) 247, 248
BseXI GCAGC 3 cut(s) 166, 223, 251
BsgI GTGCAG 1 cut(s) 165
BshFI GGCC 1 cut(s) 5
BsiHKCI CYCGRG 1 cut(s) 248
BsiSI CCGG 3 cut(s) 202, 249, 265
BsmI GAATGC 2 cut(s) 181, 222
BsnI GGCC 1 cut(s) 5
BsoBI CYCGRG 1 cut(s) 248
BspACI CCGC 1 cut(s) 338
BspANI GGCC 1 cut(s) 5
BspMAI CTGCAG 1 cut(s) 241
BssECI CCNNGG 2 cut(s) 247, 248
Bst2UI CCWGG 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 214
BstMWI GCNNNNNNNGC 1 cut(s) 159
BstNI CCWGG 1 cut(s) 7
BstSCI CCNGG 3 cut(s) 5, 247, 248
BstSFI CTRYAG 1 cut(s) 237
BstV1I GCAGC 3 cut(s) 166, 223, 251
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 214
Cfr13I GGNCC 1 cut(s) 199
Cfr9I CCCGGG 1 cut(s) 248
CviAII CATG 1 cut(s) 108
CviJI RGCY 8 cut(s) 5, 50, 95, 100, 172, 236, 294, 345
CviKI_1 RGCY 8 cut(s) 5, 50, 95, 100, 172, 236, 294, 345
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 199
Eco88I CYCGRG 1 cut(s) 248
EcoRII CCWGG 1 cut(s) 5
EcoT22I ATGCAT 1 cut(s) 113
FaeI CATG 1 cut(s) 111
FaiI YATR 5 cut(s) 74, 109, 113, 164, 261
FatI CATG 1 cut(s) 107
Fnu4HI GCNGC 3 cut(s) 180, 237, 240
Fsp4HI GCNGC 3 cut(s) 180, 237, 240
GluI GCNGC 3 cut(s) 180, 237, 240
GsuI CTGGAG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 5
HapII CCGG 3 cut(s) 202, 249, 265
Hin1II CATG 1 cut(s) 111
HpaII CCGG 3 cut(s) 202, 249, 265
HphI GGTGA 2 cut(s) 95, 293
Hpy166II GTNNAC 1 cut(s) 316
Hpy188III TCNNGA 2 cut(s) 146, 227
Hpy8I GTNNAC 1 cut(s) 316
Hpy99I CGWCG 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 5 cut(s) 111, 182, 216, 222, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
Hsp92II CATG 1 cut(s) 111
LmnI GCTCC 2 cut(s) 55, 233
LpnPI CCDG 6 cut(s) 19, 159, 212, 215, 262, 278
Lsp1109I GCAGC 3 cut(s) 166, 223, 251
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 207, 256, 328
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 3 cut(s) 125, 153, 331
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 113
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 255, 270
MslI CAYNNNNRTG 1 cut(s) 194
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 3 cut(s) 202, 249, 265
MspR9I CCNGG 3 cut(s) 7, 249, 250
Mva1269I GAATGC 2 cut(s) 181, 222
MvaI CCWGG 1 cut(s) 7
MwoI GCNNNNNNNGC 1 cut(s) 159
NciI CCSGG 2 cut(s) 249, 250
NlaIII CATG 1 cut(s) 111
NsiI ATGCAT 1 cut(s) 113
PctI GAATGC 2 cut(s) 181, 222
PkrI GCNGC 3 cut(s) 181, 238, 241
PshBI ATTAAT 1 cut(s) 255
Psp6I CCWGG 1 cut(s) 5
PspGI CCWGG 1 cut(s) 5
PspPI GGNCC 1 cut(s) 199
PstI CTGCAG 1 cut(s) 241
RseI CAYNNNNRTG 1 cut(s) 194
SaqAI TTAA 2 cut(s) 255, 270
SatI GCNGC 3 cut(s) 180, 237, 240
Sau96I GGNCC 1 cut(s) 199
ScrFI CCNGG 3 cut(s) 7, 249, 250
SetI ASST 6 cut(s) 11, 52, 97, 174, 238, 347
SfcI CTRYAG 1 cut(s) 237
SinI GGWCC 1 cut(s) 199
SmaI CCCGGG 1 cut(s) 250
SmiMI CAYNNNNRTG 1 cut(s) 194
Sse9I AATT 3 cut(s) 207, 256, 328
SsiI CCGC 1 cut(s) 338
StyD4I CCNGG 3 cut(s) 5, 247, 248
TaaI ACNGT 1 cut(s) 139
TaqII GACCGA 1 cut(s) 4
TasI AATT 3 cut(s) 207, 256, 328
Tru1I TTAA 2 cut(s) 255, 270
Tru9I TTAA 2 cut(s) 255, 270
TscAI CASTG 1 cut(s) 144
TseI GCWGC 3 cut(s) 179, 236, 239
TspMI CCCGGG 1 cut(s) 248
TspRI CASTG 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 199
VspI ATTAAT 1 cut(s) 255
XmaI CCCGGG 1 cut(s) 248
Zsp2I ATGCAT 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.