FvH4_4g25960

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
27580559 .. 27581384
826 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g25960.t1

Sequence Viewer

Length: 381 bp
ATGGGAAATTGTCTAGGATTTCCTCGTCAGGCACGGTCTAAACCAAGTACTACTGTCACTCCTTGCCGTCAGGACAACCCGAATGAGGAGGAGAAAGTCTATGAATGTCCAAAACCACCGCAGCAGCAGCGGCCCATCAACTCTGACGAGGCAGCGCGACTCTTCGGTGGGGCTGTCATCACTGACGAGGCACGGCCTAAACCAAGTACTACTGTCACTCCTCGCTGTCAGGGCAACCCTAATGAGGAGGAGAAAGTCTATGAAGGTCCAAAACCACCGCAGCAGCAGCGGCCCATCAACTCTGACGAGGCAGCGCGACTCTTCGGTGGGGCTGTCATCATTGACTATGGTACTACTACTCCGAATAAACCCACTGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

13.83

Weight (kDa)

6.31

Isoelectric Point (pI)

44.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 157, 316
AciI CCGC 4 cut(s) 119, 130, 278, 289
AfaI GTAC 3 cut(s) 49, 208, 352
AfiI CCNNNNNNNGG 2 cut(s) 85, 244
AoxI GGCC 3 cut(s) 131, 194, 290
ApeKI GCWGC 8 cut(s) 121, 124, 127, 152, 280, 283, 286, 311
AspLEI GCGC 2 cut(s) 157, 316
AspS9I GGNCC 3 cut(s) 132, 266, 291
AvaII GGWCC 1 cut(s) 266
BbvI GCAGC 8 cut(s) 133, 136, 139, 164, 292, 295, 298, 323
BccI CCATC 2 cut(s) 143, 302
BceAI ACGGC 2 cut(s) 51, 209
BfaI CTAG 1 cut(s) 14
BmcAI AGTACT 2 cut(s) 49, 208
Bme18I GGWCC 1 cut(s) 266
BmgT120I GGNCC 3 cut(s) 132, 266, 291
BsaXI ACNNNNNCTCC 6 cut(s) 43, 73, 202, 232, 343, 373
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 244
BseLI CCNNNNNNNGG 2 cut(s) 85, 244
BseRI GAGGAG 5 cut(s) 101, 104, 210, 260, 263
BseXI GCAGC 8 cut(s) 133, 136, 139, 164, 292, 295, 298, 323
Bsh1236I CGCG 2 cut(s) 157, 316
BshFI GGCC 3 cut(s) 133, 196, 292
BslI CCNNNNNNNGG 2 cut(s) 85, 244
BsnI GGCC 3 cut(s) 133, 196, 292
BspACI CCGC 4 cut(s) 119, 130, 278, 289
BspANI GGCC 3 cut(s) 133, 196, 292
BspFNI CGCG 2 cut(s) 157, 316
Bst4CI ACNGT 4 cut(s) 36, 55, 214, 376
Bst6I CTCTTC 2 cut(s) 167, 326
BstFNI CGCG 2 cut(s) 157, 316
BstHHI GCGC 2 cut(s) 157, 316
BstMWI GCNNNNNNNGC 5 cut(s) 127, 130, 231, 286, 289
BstUI CGCG 2 cut(s) 157, 316
BstV1I GCAGC 8 cut(s) 133, 136, 139, 164, 292, 295, 298, 323
BsuRI GGCC 3 cut(s) 133, 196, 292
BtsIMutI CAGTG 2 cut(s) 180, 372
CfoI GCGC 2 cut(s) 157, 316
Cfr13I GGNCC 3 cut(s) 132, 266, 291
Csp6I GTAC 3 cut(s) 48, 207, 351
CviJI RGCY 5 cut(s) 133, 173, 196, 292, 332
CviKI_1 RGCY 5 cut(s) 133, 173, 196, 292, 332
CviQI GTAC 3 cut(s) 48, 207, 351
Eam1104I CTCTTC 2 cut(s) 167, 326
EarI CTCTTC 2 cut(s) 167, 326
Eco47I GGWCC 1 cut(s) 266
FaiI YATR 3 cut(s) 102, 261, 348
FspBI CTAG 1 cut(s) 14
GlaI GCGC 2 cut(s) 156, 315
HaeIII GGCC 3 cut(s) 133, 196, 292
HhaI GCGC 2 cut(s) 157, 316
Hin6I GCGC 2 cut(s) 155, 314
HinP1I GCGC 2 cut(s) 155, 314
HinfI GANTC 2 cut(s) 159, 318
Hpy188I TCNGA 3 cut(s) 145, 304, 363
Hpy188III TCNNGA 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 257
HpyCH4III ACNGT 4 cut(s) 36, 55, 214, 376
HpyF10VI GCNNNNNNNGC 5 cut(s) 127, 130, 231, 286, 289
HspAI GCGC 2 cut(s) 155, 314
LpnPI CCDG 3 cut(s) 14, 56, 215
Lsp1109I GCAGC 8 cut(s) 133, 136, 139, 164, 292, 295, 298, 323
MaeI CTAG 1 cut(s) 14
MaeIII GTNAC 2 cut(s) 55, 214
MboII GAAGA 2 cut(s) 154, 313
MluCI AATT 1 cut(s) 7
MlyI GAGTC 2 cut(s) 153, 312
MnlI CCTC 9 cut(s) 33, 79, 82, 142, 181, 231, 238, 241, 301
MspA1I CMGCKG 2 cut(s) 130, 289
MvnI CGCG 2 cut(s) 157, 316
MwoI GCNNNNNNNGC 5 cut(s) 127, 130, 231, 286, 289
NmuCI GTSAC 2 cut(s) 55, 214
PleI GAGTC 2 cut(s) 153, 312
PpsI GAGTC 2 cut(s) 153, 312
PspPI GGNCC 3 cut(s) 132, 266, 291
RsaI GTAC 3 cut(s) 49, 208, 352
RsaNI GTAC 3 cut(s) 48, 207, 351
Sau96I GGNCC 3 cut(s) 132, 266, 291
ScaI AGTACT 2 cut(s) 49, 208
SchI GAGTC 2 cut(s) 153, 312
SetI ASST 1 cut(s) 268
SinI GGWCC 1 cut(s) 266
Sse9I AATT 1 cut(s) 7
SsiI CCGC 4 cut(s) 119, 130, 278, 289
SspMI CTAG 1 cut(s) 14
TaaI ACNGT 4 cut(s) 36, 55, 214, 376
TasI AATT 1 cut(s) 7
TatI WGTACW 2 cut(s) 47, 206
TauI GCSGC 2 cut(s) 133, 292
TscAI CASTG 2 cut(s) 187, 379
TseFI GTSAC 2 cut(s) 55, 214
TseI GCWGC 8 cut(s) 121, 124, 127, 152, 280, 283, 286, 311
Tsp45I GTSAC 2 cut(s) 55, 214
TspDTI ATGAA 2 cut(s) 117, 276
TspRI CASTG 2 cut(s) 187, 379
VpaK11BI GGWCC 1 cut(s) 266
XspI CTAG 1 cut(s) 14
ZrmI AGTACT 2 cut(s) 49, 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.